NRBP1 modulates uric acid transporter ABCG2 expression by activating the Wnt/β-catenin pathway in HK-2 cells

array:24 ["pii" => "S0211699521002332" "issn" => "02116995" "doi" => "10.1016/j.nefro.2021.09.010" "estado" => "S300" "fechaPublicacion" => "2023-03-01" "aid" => "984" "copyright" => "Sociedad Española de Nefrología" "copyrightAnyo" => "2021" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Nefrologia. 2023;43:204-12" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:19 [ "pii" => "S0211699521002368" "issn" => "02116995" "doi" => "10.1016/j.nefro.2021.10.001" "estado" => "S300" "fechaPublicacion" => "2023-03-01" "aid" => "987" "copyright" => "Sociedad Española de Nefrología" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Nefrologia. 2023;43:213-23" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Low dose thymoglobulin versus basiliximab in cytomegalovirus positive kidney transplant recipients: Effectiveness of preemptive cytomegalovirus modified strategy" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "213" "paginaFinal" => "223" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Timoglobulina en dosis bajas vs. basiliximab en receptores de trasplante renal positivos para citomegalovirus: efectividad de una estrategia preventiva modificada" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1579 "Ancho" => 1508 "Tamanyo" => 73049 ] ] "descripcion" => array:1 [ "en" => "Viremia onset and duration distributions according to induction type." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Camilo Montero, Nancy Yomayusa, Rodolfo Torres, Jorge Cortes, Carlos Alvarez, Juan Gallo, Guillermo Aldana, Andres Acevedo, Maria Rios, Johana Echeverri, Zuly Yepes, Adriana Silva, Diana Gayon, Jorge Perez, Milciades Ibanez" "autores" => array:15 [ 0 => array:2 [ "nombre" => "Camilo" "apellidos" => "Montero" ] 1 => array:2 [ "nombre" => "Nancy" "apellidos" => "Yomayusa" ] 2 => array:2 [ "nombre" => "Rodolfo" "apellidos" => "Torres" ] 3 => array:2 [ "nombre" => "Jorge" "apellidos" => "Cortes" ] 4 => array:2 [ "nombre" => "Carlos" "apellidos" => "Alvarez" ] 5 => array:2 [ "nombre" => "Juan" "apellidos" => "Gallo" ] 6 => array:2 [ "nombre" => "Guillermo" "apellidos" => "Aldana" ] 7 => array:2 [ "nombre" => "Andres" "apellidos" => "Acevedo" ] 8 => array:2 [ "nombre" => "Maria" "apellidos" => "Rios" ] 9 => array:2 [ "nombre" => "Johana" "apellidos" => "Echeverri" ] 10 => array:2 [ "nombre" => "Zuly" "apellidos" => "Yepes" ] 11 => array:2 [ "nombre" => "Adriana" "apellidos" => "Silva" ] 12 => array:2 [ "nombre" => "Diana" "apellidos" => "Gayon" ] 13 => array:2 [ "nombre" => "Jorge" "apellidos" => "Perez" ] 14 => array:2 [ "nombre" => "Milciades" "apellidos" => "Ibanez" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699521002368?idApp=UINPBA000064" "url" => "/02116995/0000004300000002/v1_202303240922/S0211699521002368/v1_202303240922/en/main.assets" ] "itemAnterior" => array:19 [ "pii" => "S0211699521002319" "issn" => "02116995" "doi" => "10.1016/j.nefro.2021.09.009" "estado" => "S300" "fechaPublicacion" => "2023-03-01" "aid" => "982" "copyright" => "Sociedad Española de Nefrología" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Nefrologia. 2023;43:197-203" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Etelcalcetide controls secondary hyperparathyroidism and raises sclerostin levels in hemodialysis patients previously uncontrolled with cinacalcet" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "197" "paginaFinal" => "203" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Etelcalcetida controla el hiperparatiroidismo secundario y eleva los niveles de esclerostina en pacientes en hemodiálisis previamente no controlados con cinacalcet" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1942 "Ancho" => 1583 "Tamanyo" => 108549 ] ] "descripcion" => array:1 [ "en" => "Plasma sclerostin levels at baseline and after 6 months of etelcalcetide treatment." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Luciano Artur Lopes Pereira, Catarina Meng, Manuel Augusto Gonçalves Amoedo, Maria Teresa de Sousa Costa Pinto Ferreira Mendes, Marco Alexandre Mateus Prazeres Marques, João Miguel Machado Dória Frazão, André Luiz Loureiro Weigert" "autores" => array:7 [ 0 => array:2 [ "nombre" => "Luciano Artur Lopes" "apellidos" => "Pereira" ] 1 => array:2 [ "nombre" => "Catarina" "apellidos" => "Meng" ] 2 => array:2 [ "nombre" => "Manuel Augusto Gonçalves" "apellidos" => "Amoedo" ] 3 => array:2 [ "nombre" => "Maria Teresa de Sousa Costa Pinto Ferreira" "apellidos" => "Mendes" ] 4 => array:2 [ "nombre" => "Marco Alexandre Mateus Prazeres" "apellidos" => "Marques" ] 5 => array:2 [ "nombre" => "João Miguel Machado Dória" "apellidos" => "Frazão" ] 6 => array:2 [ "nombre" => "André Luiz Loureiro" "apellidos" => "Weigert" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699521002319?idApp=UINPBA000064" "url" => "/02116995/0000004300000002/v1_202303240922/S0211699521002319/v1_202303240922/en/main.assets" ] "en" => array:19 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "NRBP1 modulates uric acid transporter ABCG2 expression by activating the Wnt/β-catenin pathway in HK-2 cells" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "204" "paginaFinal" => "212" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Qiankun Zhang, Hang Fang, Zaihua Zhu" "autores" => array:3 [ 0 => array:3 [ "nombre" => "Qiankun" "apellidos" => "Zhang" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 1 => array:3 [ "nombre" => "Hang" "apellidos" => "Fang" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 2 => array:4 [ "nombre" => "Zaihua" "apellidos" => "Zhu" "email" => array:1 [ 0 => "qiankunzhangphd@126.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Division of Nephrology, Lishui Central Hospital and Fifth Affiliated Hospital of Wenzhou Medical College, Lishui 323000, China" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Institute of Nephrology, Zhejiang University, Hangzhou 310003, China" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Division of Rheumatology and Immunology, Huashan Hospital Fudan University, Shanghai 200000, China" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "NRBP1 regula la expresión del transportador de ácido úrico ABCG2 en las células HK-2 mediante la activación de la vía Wnt/β-catenina" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1046 "Ancho" => 3333 "Tamanyo" => 187178 ] ] "descripcion" => array:1 [ "en" => "Effect of NRBP1 knockdown or overexpression on the Wnt/β-catenin signaling pathway in HK-2 cells. A, Western blot was used to analyze the expression levels of β-catenin, p-β-catenin, GSK3β and p-GSK3β in stably si-NRBP1-transfected or NRBP-1 overexpression HK-2 cells. B–C, Semi-quantification of the expression levels of proteins in parts A. (χ¯±s,n=3), *P<0.05, **P<0.01 vs. Control group, #P<0.05, ##P<0.01 vs. Model group." ] ] ] "textoCompleto" => "IntroductionGout is a serious health issue with a prevalence of 1.14% in adults in China,<a class="elsevierStyleCrossRef" href="#bib0200">1</a> and is an independent risk factor for heart failure and metabolic syndrome.<a class="elsevierStyleCrossRef" href="#bib0205">2</a> It is associated with many conditions that affect longevity, such as hypertension, diabetes mellitus, metabolic syndrome, and renal and cardiovascular disease.<a class="elsevierStyleCrossRefs" href="#bib0210">3–6</a> Hyperuricemia is considered to be a precursor of gout as the deposition of urate crystals in the joints and soft tissue results in an acute inflammatory response and tophi, respectively.<a class="elsevierStyleCrossRefs" href="#bib0230">7,8</a> In recent years, the trend in the prevalence of gout and hyperuricemia have been observed increased in epidemiological studies,<a class="elsevierStyleCrossRefs" href="#bib0240">9,10</a> and the diseases have become public health problems that need to be solved quickly.Generally, hyperuricemia has been classified into urate ‘overproduction type’ and/or ‘underexcretion type’ based solely on renal urate excretion, without considering an extra-renal pathway.<a class="elsevierStyleCrossRef" href="#bib0250">11</a> Uric acid is principally derived from purine metabolism.<a class="elsevierStyleCrossRef" href="#bib0255">12</a> And hyperuricemia was caused by metabolism abnormalities of serum uric acid.<a class="elsevierStyleCrossRef" href="#bib0260">13</a> In humans, kidney plays a pivotal role in urate handling, the mechanism is to maintain the balance between secretory and efficient reabsorption.<a class="elsevierStyleCrossRef" href="#bib0265">14</a> The reduction of glomerular filtration, increased tubular resorption, and decreased tubular secretion of uric acid all induced the impairment of renal excretion of uric acid.<a class="elsevierStyleCrossRef" href="#bib0270">15</a> The excretion of uric acid in the kidney is assisted by uric acid transporters, which have uric acid reabsorption transporters and uric acid secretion transporters. The renal proximal nephron plays a major role in the reabsorption of glucose from the urine using a combination of sodium-coupled hexose transporters, urate transporter 1 (URAT1, SLC22A12) and glucose transporter 9 (GLUT9, SLC2A9).<a class="elsevierStyleCrossRef" href="#bib0275">16</a> At the same time, the transporters of ATP-binding cassette subfamily G member 2 (ABCG2) and organic anion transporter 1 (OAT1, SLC22A6) play major roles in the uric acid secretion.<a class="elsevierStyleCrossRefs" href="#bib0280">17,18</a>Dozens of loci associated with gout were identified by genome-wide association studies, and nuclear receptor binding protein 1 (NRBP1) is one of the risk genes. At the same time, it has been confirmed that the expression of NRBP1 was elevated in human peripheral blood mononuclear cells from gout patients.<a class="elsevierStyleCrossRef" href="#bib0200">1</a> Previous studies suggested that NRBP1 can inhibit the proliferation of tumor cells by activating Wnt/β-catenin signaling pathways.<a class="elsevierStyleCrossRefs" href="#bib0290">19,20</a> Several studies have also found that the activation of Wnt/β-catenin signaling pathway can lead to the expression of uric acid transporter ABCG2 decrease.<a class="elsevierStyleCrossRefs" href="#bib0300">21,22</a> ABCG2, as the most important uric acid transporter, is mainly distributed in the proximal renal tubule of the kidney, and its decreased expression is the pathophysiological basis for the occurrence of hyperuricemia and gout. Therefore, we hypothesized that NRBP1 could induce the expression of uric acid transporters ABCG2 decrease in the renal proximal nephron by activating the Wnt/β-catenin signaling pathway, to further induce the hyperuricemia.In this study, we used the overexpression and knockdown of NRBP1 in the HK-2 cells to evaluate its effect on the uric acid transporter. In addition, the effects of blocking Wnt/β-catenin signaling pathways on NRBP1 mediated ABCG2 expression were also investigated. According to our observations, the overexpression of NRBP1 induced the expression of ABCG2, which promotes uric acid reabsorption and inhibits uric acid secretion. And the inhibition of NRBP1 on the expression of ABCG2 was by activating the Wnt/β-catenin pathway in HK-2 cells. This finding will help pinpoint the causes of hyperuricemia more accurately and provide a more effective therapeutic strategy for hyperuricemia and gout, leading to a good model of personalized medicine for common diseases.Materials and methodsCells cultureHuman renal proximal tubular epithelial cells (HK-2 cells) were purchased from the Shanghai Baiye Biotechnology Center (China). HK-2 cells were cultured in DMEM medium (HyClone, USA) containing 10% fetal bovine serum (Zhejiang Tianhang Biotechnology Co. Ltd., China) at 37°C in a humidified 5% CO2 air atmosphere.Lentivirus infectionsThe lentivirus encoding the human NRBP1 gene and green fluorescent proteins (GFP) were purchased from Shanghai GenePharma Co Ltd, China. The target cells were infected with the lentivirus according to the manufacturers’ instructions. The transfection effect 72h after infection was observed by fluorescence microscope camera, and the expression of NBRP1 was confirmed by western blot.RNA interferenceOne short interfering RNA (siRNA) targeting the NRBP1 sequence (siNRBP1: GTCGAGAAGAGCAGAAGAA) was synthesized. siRNA targeting NRBP1 or scrambled siRNA (negative control, siCONT) were transfected using Lipofectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA) to knock down endogenous NRBP1. Total protein was collected from cells to analyze NRBP1 silencing efficiency.Treatment of HK-2 cellsAfter the confirmation of NRBP1 overexpression and knockdown efficiency, HK-2 cells were assigned into 4 groups: control group (HK-2 cells cultured in normal DMEM medium), model group (HK-2 cells cultured in DMEM medium contain 400μmol/L uric acid), Lenti-NRBP1 group (HK-2 cells infected with the NRBP1 lentivirus and cultured in normal DMEM medium), and si-NRBP1 group (HK-2 cells were transfected by NRBP1 siRNA and cultured in DMEM medium contain 400μmol/L uric acid). After 48h of co-cultured, the further experiment was performed.Quantitative real-time polymerase chain reaction (qRT-PCR)In order to determine the effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid, the mRNAs expression of ABCG2, OAT1, GLUT9 and URAT1 were detected by qRT-PCR. Total RNA was extracted from each group using Trizol reagent (Bioengineering Company Limited, China) according to the manufacturer's instructions. Then it was reverse transcription to cDNA, amplified and analyzed using SYBR Green PCR Master Mix (Kangwei Century Biotechnology Co. Ltd, China) and a CFX96 real-time system (Bio-Rad, USA). Each group was analyzed in triplicate. The original threshold cycle (Ct) values were standardized with β-actin by the 2−ΔΔCt method. The primer sequences used are shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Immunofluorescence (IF) stainingTo determine the cellular location of ABCG2 and its expression after NRBP1 overexpression and knockdoen, IF staining was performed. The treated HK-2 cells were fixed using 4% paraformaldehyde for 10min, washed with PBS three times, and permeabilized with 0.5% Triton X-100 (Sigma, St. Louis, MO, USA) for an additional 2min. After blocking with 3% bovine serum albumin (BSA) for 0.5h, ABCG2 was detected using mouse anti-human ABCG2 mAb (1:100, ab229193, abcam, USA) overnight. After washing, the cells were incubated with secondary antibody at room temperature. Finally, the cellular nuclei were stained by DAPI (40,6-diamidino-2-phenylindole) (Sigma, USA). The samples were observed under a fluorescence microscope (Nikon, Japan). The ImageJ software was used to quantify the fluorescence density.Protein extraction and western blotThe efficiency of NRBP1 overexpression and knockdown, effects of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid and Wnt/β-catenin signal pathway were all detected by western blot. Cellular protein was extracted from the cells transfected with or without siNRBP1 using RIPA lysis buffer (Beyotime Biotechnology, China). The protein concentration was detected using the bicinchoninic acid (BCA) protein quantification kit (Solarbio, Beijing, China). Equivalent amounts of protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently transferred to polyvinylidene fluoride (PVDF) membranes. Then the protein blots were incubated with primary antibodies overnight at 4°C. After washing three times with TBST buffer and the protein blots were incubated with secondary antibody at room temperature for 1–2h. The reactive bands were visualized by use of the ECL-Plus reagent (Solarbio, Beijing, China). The density of band was quantified by the Quantity One analytic software. The primary antibodies including anti-beta Actin antibody (1:1000, ab8227, Abcam, USA), NRBP1 antibody (1:1000, DF10146, Affinity, USA), ABCG2 antibody (1:500, AF5177, Affinity, USA), Anti-SLC22A6 antibody (1:500, ab135924, Abcam, USA), Anti-GLUT9 antibody (1:500, ab223470, Abcam, USA), URAT1antibody (1:500, DF12340, Affinity, USA), Anti-beta Catenin antibody (0.25μg/mL, ab16051, Abcam, USA), GSK3 beta antibody (1:500, ab53050, Affinity, USA) and GSK3 beta antibody (1:500, ab53050, Affinity, USA).21H7 treatment21H7 is a selective inhibitor of the Wnt/β-catenin pathway that destabilizes β-catenin.<a class="elsevierStyleCrossRef" href="#bib0310">23</a> The HK-2 cells were divided into four group: model group, model+21H7 group, Lenti-NRBP1 group and Lenti-NRBP1+21H7 group. After transfection with NRBP1 lentivirus, HK-2 cells were treated with or without 21H7 (4μM, Sigma-Aldrich, USA) for 48h.<a class="elsevierStyleCrossRef" href="#bib0315">24</a> After that, the proteins expression of NRBP1, ABCG2, β-catenin, p-β-catenin, GSK-3β and p-GSK-3β were detected by western blot.Statistical analysisThe statistical analyses were performed using SPSS 16.0 (IBM, Armonk, NY, USA). Values are expressed as χ¯±s. Comparisons of multiple independent groups were analyzed using One-way ANOVA followed SNK post hoc test. In all cases, P<0.05 was considered as statistical significance.ResultsEfficiency of NRBP1 transfection and knockdownLentivirus system was used to generate stable NRBP1 overexpression in HK-2 cells. Western blot analysis showed that NRBP1 protein expression was significantly elevated in HK-2 cells transduced with Lenti-NRBP1 (P<0.01, <a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). At the same time, plasmids carrying a NRBP1 siRNA was generated to knockdown NRBP1 expression in HK-2 cells. A reduced protein level of NRBP1 in HK-2 cells transduced with NRBP1 siRNA was verified by western blot (P<0.01). Taken together, the efficiency of NRBP1 transfection and silencing were significant.<elsevierMultimedia ident="fig0005"></elsevierMultimedia>Effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acidThe mRNAs and proteins related to the secretion and reabsorption of uric acid such as ABCG2, OAT1, GLUT9 and URAT1 were detected by qRT-PCR and western blot. Compared with control group, the mRNAs and proteins expression of NRBP1, GLUT9 and URAT1 were significantly increased in model and si-NRBP1 group, while ABCG2 and OAT1 were decreased in model group (P<0.05, <a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>). Compared with model group, the mRNAs and proteins expression of GLUT9 and URAT1 was decreased significantly in Lenti-NRBP1 group (P<0.01). At the same time, the mRNAs and proteins expression of ABCG2 and NRBP1 in si-NRBP1 were significantly increased and decreased, respectively (P<0.01). Therefore, ABCG2 might be the target of NRBP1 for the treatment of hyperuricemia.<elsevierMultimedia ident="fig0010"></elsevierMultimedia>NRBP1 inhibited ABCG2 expression in the HK-2 cellsBecause NRBP1 is a gout risk gene, we hypothesized that NRBP1 could regulate the ABCG2 mRNA and protein expression in proximal tubular epithelial cells, and then affect renal urate excretion. According to IF results (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>), NRBP1 overexpression inhibited the expression of ABCG2 in HK-2 cells (P<0.01). Compared with model group, the expression of ABCG2 was significantly increased in the si-NRBP1 group (P<0.01). The results provided compelling evidence regarding the inhibition effects of NRBP1 on the protein expression of ABCG2.<elsevierMultimedia ident="fig0015"></elsevierMultimedia>Effect of NRBP1 knockdown or overexpression on the Wnt/β-catenin signaling pathway in HK-2 cellsAccording to the western blot results (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>), the ratio of p-β-catenin/β-catenin was significantly upregulated in siNRBP1-transfected HK-2 cells compared with the model group (P<0.01). However, the ratio of p-GSK3β/GSK3β was significantly downregulated in siNRBP1-transfected HK-2 cells compared with the model group (P<0.01). In contrast, the ratio of p-GSK3β/GSK3β in stable NRBP1 overexpressing HK-2 cells was significantly upregulated (P<0.01), while the ratio of p-β-catenin/β-catenin was significantly downregulated (P<0.01), compared with the control group. Taken together, these findings suggested that NRBP1 may have a regulating role in the progression of renal urate excretion by activating the Wnt/β-catenin signaling pathway.<elsevierMultimedia ident="fig0020"></elsevierMultimedia>Effect of blocking Wnt/β-catenin pathway on NRBP1 mediated ABCG2 expressionIn order to further explored the effect of the Wnt/β-catenin pathway on NRBP1 mediated ABCG2 expression, the proteins expression of NRBP1, β-catenin, p-β-catenin, GSK-3β, p-GSK-3β and ABCG2 in HK-2 cells was performed by western blot after treated with the Wnt/β-catenin inhibitor 21H7. As shown in the <a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>, in the model+21H7 and Lenti-NRBP1+21H7 group HK-2 cells, the ratio of p-β-catenin/β-catenin and ABCG2 expression was markedly elevated (P<0.01), while the ratio of p-GSK-3β/GSK-3β was markedly decreased (P<0.01) compared with model and Lenti-NRBP1 group HK-2 cells. In addition, there was no influence on the protein expression of NRBP1 after blocked the Wnt/β-catenin pathway both in model and Lenti-NRBP1 group (P>0.05). These results suggested that NRBP1 modulates uric acid transporter ABCG2 expression by activating the Wnt/β-catenin pathway in HK-2 cells.<elsevierMultimedia ident="fig0025"></elsevierMultimedia>DiscussionAt present, the classification of hyperuricemia is based on the understanding of its mechanism by which hyperuricemia results from either overproduction of urate due to a metabolism disorder, underexcretion by abnormal renal urate transport activity, or the combination of both.<a class="elsevierStyleCrossRefs" href="#bib0320">25,26</a> The main cause of hyperuricemia is ‘renal urate underexcretion’, and ‘urate overproduction’ is considered as another common cause.<a class="elsevierStyleCrossRefs" href="#bib0330">27,28</a> In the body, about 2/3 of urate is excreted by the kidney, while the other 1/3 of urate is excreted from the intestine into feces and broken down by colonic bacteria.<a class="elsevierStyleCrossRef" href="#bib0340">29</a> Therefore, to improving uric acid excretion or inhibiting uric acid reabsorption via the kidney to reduce the level of uric acid might be a main effective approach to the prevention and treatment of gout and hyperuricemia.A number of urate transport in the kidney regulate urate excretion and reabsorption to control uric acid balance in the blood.<a class="elsevierStyleCrossRef" href="#bib0345">30</a> Among them, URAT1 and GLUT9 regulate uric acid reabsorption, while ABCG2 and OAT1 regulate urate excretion.<a class="elsevierStyleCrossRefs" href="#bib0350">31,32</a> The dysregulation of these urate transporters alters urate control in the body, increasing the risk for hyperuricemia.<a class="elsevierStyleCrossRefs" href="#bib0330">27,33</a> At present, the common dysfunctional variants of ABCG2 decrease extra-renal urate excretion including gut excretion and cause hyperuricemia.<a class="elsevierStyleCrossRefs" href="#bib0365">34,35</a>NRBP1 is a gout risk gene. In previous study, the hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression, which contribute to the development of gout.<a class="elsevierStyleCrossRef" href="#bib0285">18</a> Before this, it has been showed that NRBP1 plays an important role in tumor suppression, cellular homoeostasis, and protein regulation by regulating the Wnt/β-catenin signaling pathway.<a class="elsevierStyleCrossRefs" href="#bib0375">36,37</a> Meanwhile, the urate transporters ABCG2 was regulated by Wnt/β-catenin signaling pathway.<a class="elsevierStyleCrossRef" href="#bib0385">38</a> Interestingly, we found that HK-2 cells which overexpressed NRBP1 or NRBP1 knockdown can regulate the expression of ABCG2. However, the expression of NRBP1 had no significant effect on the expression of another urate transporters OAT1. In addition, compared with model group, the overexpression of NRBP1 also decreased the expression of GLUT9 and URAT1, but the NRBP1 knockdown had no significant effect on the expression of GLUT9 and URAT1. Therefore, we thought that NRBP1 overexpression decreased the expression of ABCG2 resulted in the accumulation of uric acid, further to induced gout or hyperuricemia, and illustrated that the uric acid transporter ABCG2 might be the target of NRBP1.Therefore, we further explored whether the Wnt/β-catenin signaling pathway was involved in the regulation of NRBP1 on the expression ABCG2. In previous study has shown that NRBP1 was downregulated in breast cancer and its overexpression inhibits cancer cell proliferation through Wnt/β-catenin signaling pathway.<a class="elsevierStyleCrossRef" href="#bib0290">19</a> Wnt/β-catenin signaling pathway also plays an important role in hyperuricemia nephropathy. The inactivation of the Wnt/β-catenin signaling pathway could induce the blockade of ERK1/2, and the inhibition of ERK1/2 could have therapeutic potential for treatment of hyperuricemic nephropathy.<a class="elsevierStyleCrossRef" href="#bib0390">39</a> In this study, the ratio of proteins related to the Wnt/β-catenin signaling pathway, including p-β-catenin/β-catenin and p-GSK-3β/GSK-3β, were downregulated and upregulated respectively following NRBP1 overexpression, indicating that the Wnt/β-catenin signaling pathway may be activated. In contrast, following the knockdown of NRBP1, the ratio p-GSK3β/GSK3β was significantly downregulated in HK-2 cells, while the ratio p-β-catenin/β-catenin was upregulated, suggesting that the Wnt/β-catenin signaling pathway may be inhibited.In addition, the inhibitor of β-catenin 21H7 was used to further explored the role of the Wnt/β-catenin signaling pathway in NRBP1 modulates uric acid transporter ABCG2 expression. In the model and Lenti-NRBP1 HK-2 cells, the addition of the β-catenin inhibitor 21H7 didn’t affect the expression of NRBP1, but increased the expression of ABCG2 and the ratio of p-β-catenin/β-catenin. Meanwhile, the ratio of p-GSK-3β/GSK-3β was significant. Thus, these results indicated that NRBP1 may serve a role in modulates uric acid transporter ABCG2 expression by activating the Wnt/β-catenin signaling pathway.In conclusion, NRBP1 can inhibit the development of hyperuricemia by mediating the expression of ABCG2 to promote uric acid excretion via the kidney in HK-2 cells. Furthermore, NRBP1 was found to modulate uric acid transporter ABCG2 expression by activating the Wnt/β-catenin signaling pathway. The functional and mechanistic investigations suggested that the interactions between NRBP1 and GSK-3β, which may positively regulate β-catenin, may be the trigger for the activation of the Wnt/β-catenin signaling pathway in the modulates uric acid transporter ABCG2 expression. This study may provide pharmacological evidence to support the anti-hyperuricemic effect of knockdown NRBP1 in the treatment of hyperuricemia and gout.Authors’ contributionsZaihua Zhu and Qiankun Zhang conceived and designed the study and performed the experiments and analyzed the data. Hang Fang contributed materials, data and assisted in data analysis; Qiankun Zhang and Hang Fang were the major contributor in writing the manuscript. All authors read and approved the final manuscript.FundingThis study was supported by the funds from Project of the Natural Science Foundation of Zhejiang Province (Grant No.LY20H050009) to Qiankun Zhang and the National Natural ScienceFoundation of China (Grant No. 81701594) to Zaihua Zhu.Conflict of interestAll authors declare that they have no conflict of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:12 [ 0 => array:3 [ "identificador" => "xres1866036" "titulo" => "Abstract" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1621297" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1866037" "titulo" => "Resumen" "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1621298" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Materials and methods" "secciones" => array:9 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Cells culture" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Lentivirus infections" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "RNA interference" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Treatment of HK-2 cells" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Quantitative real-time polymerase chain reaction (qRT-PCR)" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Immunofluorescence (IF) staining" ] 6 => array:2 [ "identificador" => "sec0045" "titulo" => "Protein extraction and western blot" ] 7 => array:2 [ "identificador" => "sec0050" "titulo" => "21H7 treatment" ] 8 => array:2 [ "identificador" => "sec0055" "titulo" => "Statistical analysis" ] ] ] 6 => array:3 [ "identificador" => "sec0060" "titulo" => "Results" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "sec0065" "titulo" => "Efficiency of NRBP1 transfection and knockdown" ] 1 => array:2 [ "identificador" => "sec0070" "titulo" => "Effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid" ] 2 => array:2 [ "identificador" => "sec0075" "titulo" => "NRBP1 inhibited ABCG2 expression in the HK-2 cells" ] 3 => array:2 [ "identificador" => "sec0080" "titulo" => "Effect of NRBP1 knockdown or overexpression on the Wnt/β-catenin signaling pathway in HK-2 cells" ] 4 => array:2 [ "identificador" => "sec0085" "titulo" => "Effect of blocking Wnt/β-catenin pathway on NRBP1 mediated ABCG2 expression" ] ] ] 7 => array:2 [ "identificador" => "sec0090" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0095" "titulo" => "Authors’ contributions" ] 9 => array:2 [ "identificador" => "sec0100" "titulo" => "Funding" ] 10 => array:2 [ "identificador" => "sec0105" "titulo" => "Conflict of interest" ] 11 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2021-03-30" "fechaAceptado" => "2021-09-04" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1621297" "palabras" => array:5 [ 0 => "Gout" 1 => "Nuclear receptor binding protein 1" 2 => "ATP-binding cassette subfamily G member 2" 3 => "Wnt/β-catenin" 4 => "Uric acid transporter" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1621298" "palabras" => array:5 [ 0 => "Gota" 1 => "Proteína de unión al receptor nuclear 1" 2 => "ATP-binding cassette subfamily G member" 3 => "Wnt/β-catenina" 4 => "Transportador de ácido úrico" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "BackgroundNuclear receptor binding protein 1 (NRBP1) and ATP-binding cassette subfamily G member 2 (ABCG2) was the gout risk gene and high-capacity urate exporter respectively. However, the relationship between NRBP1 and ABCG2 and the underlying molecular mechanism contributing to these associations are unknown. MethodsFirstly, the efficiency of the overexpression and knockdown of NRBP1 was confirmed by western blot. Next, the effect of NRBP1 overexpression and knockdown on the expression of ABCG2, organic anion transporter 1 (OAT1), glucose transporter 9 (GLUT9) and urate transporter 1 (URAT1) was detected by qRT-PCR and western blot. At the same time, the cellular location of ABCG2 and its expression after NRBP1 overexpression and knockdown was tested by immunofluorescence (IF) staining. Then, the mechanism of NRBP1 modulates ABCG2 expression was evaluated by western blot with or without the β-catenin inhibitor (21H7). ResultsThe lentivirus system was used to generate stable NRBP1 overexpression, while the plasmids carrying a NRBP1 siRNA was generated to knockdown NRBP1 expression in HK-2 cells. Meanwhile, the overexpression of NRBP1 significantly decreased the mRNAs and proteins expression of GLUT9 and URAT1, while the knockdown of NRBP1 increased the mRNAs and proteins expression of ABCG2 significantly. In addition, the NRBP1 modulates the expression of ABCG2 was by ctivating the Wnt/β-catenin pathway in HK-2 cells according to the IF and western blot results. ConclusionTaken together, our study demonstrated that NRBP1 inhibition played an essential role in attenuating hyperuricemia and gout by upregulation of ABCG2 via Wnt/β-catenin signaling pathway in HK-2 cells." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Methods" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Results" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "AntecedentesLa proteína de unión al receptor nuclear 1 (NRBP1) y el miembro G de la subclase ATP binding Box 2 (ABCG2) son los genes de riesgo de gota y los genes de salida de urato de alto rendimiento, respectivamente. Sin embargo, se desconoce la relación entre NRBP1 y ABCG2, y los posibles mecanismos moleculares que conducen a estas asociaciones. MétodosEn primer lugar, la sobreexpresión y el knockout de NRBP1 fueron confirmados por Western-blot. Los efectos de la sobreexpresión y knockout de NRBP1 en la expresión de ABCG2, transportador de aniones orgánicos 1 (OAT1), transportador de glucosa 9 (GLUT9) y transportador de ácido úrico 1 (URAT1) fueron detectados por qRT-PCR y Western-blot. Mientras tanto, la localización y expresión de ABCG2 después de la sobreexpresión y knockout de NRBP1 fueron detectadas por inmunofluorescencia (IF). Luego, el efecto regulador de NRBP1 sobre la expresión de ABCG2 fue estudiado por Western-blot y comparado con el inhibidor de la β-catenina (21H7). ResultadosEl sistema lentiviral indujo una sobreexpresión estable de NRBP1, mientras que el plásmido portador de SiRNA NRBP1 inhibió la expresión de NRBP1 en las células HK-2. Mientras tanto, la sobreexpresión de NRBP1 redujo significativamente la expresión de ARNm y proteínas de GLUT9 y URAT1, mientras que el knockout de NRBP1 aumentó significativamente la expresión de ARNm y proteínas de ABCG2. Además, de acuerdo con los resultados de IF y Western-blot, NRBP1 regula la expresión de ABCG2 activando la vía Wnt/β-catenina en las células HK-2. ConclusiónLa inhibición del NRBP1 aumenta la regulación de ABCG2 a través de la vía de señalización Wnt/β-catenina, que desempeña un papel importante en la reducción de la hiperuricemia y la gota." "secciones" => array:4 [ 0 => array:2 [ "identificador" => "abst0025" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0030" "titulo" => "Métodos" ] 2 => array:2 [ "identificador" => "abst0035" "titulo" => "Resultados" ] 3 => array:2 [ "identificador" => "abst0040" "titulo" => "Conclusión" ] ] ] ] "multimedia" => array:6 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 2523 "Ancho" => 2167 "Tamanyo" => 224405 ] ] "descripcion" => array:1 [ "en" => "Efficiency of NRBP1 transfection and silencing was confirmed by western blot. (χ¯±s,n=3), *P<0.05, **P<0.01 vs. Control group." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 3768 "Ancho" => 3333 "Tamanyo" => 550565 ] ] "descripcion" => array:1 [ "en" => "Effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid. A, Effect of NRBP1 overexpression and knockdown on the mRNA expression of NRBP1, ABCG2, OAT1, GLUT9 and URAT1. B, Effect of NRBP1 overexpression and knockdown on the protein expression of NRBP1, ABCG2, OAT1, GLUT9 and URAT1. (χ¯±s,n=3), *P<0.05, **P<0.01 vs. Control group, #P<0.05, ##P<0.01 vs. Model group." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 1283 "Ancho" => 3333 "Tamanyo" => 472150 ] ] "descripcion" => array:1 [ "en" => "NRBP1 reduced the expression of ABCG2 protein level in HK-2 cells. A, Representative imaging from immunofluorescent staining (original magnification ×200). B, The relative fluorescent intensity for each group. (χ¯±s,n=3), *P<0.05, **P<0.01 vs. Control group, #P<0.05, ##P<0.01 vs. Model group." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 1046 "Ancho" => 3333 "Tamanyo" => 187178 ] ] "descripcion" => array:1 [ "en" => "Effect of NRBP1 knockdown or overexpression on the Wnt/β-catenin signaling pathway in HK-2 cells. A, Western blot was used to analyze the expression levels of β-catenin, p-β-catenin, GSK3β and p-GSK3β in stably si-NRBP1-transfected or NRBP-1 overexpression HK-2 cells. B–C, Semi-quantification of the expression levels of proteins in parts A. (χ¯±s,n=3), *P<0.05, **P<0.01 vs. Control group, #P<0.05, ##P<0.01 vs. Model group." ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 2073 "Ancho" => 3333 "Tamanyo" => 328713 ] ] "descripcion" => array:1 [ "en" => "NRBP1 regulates uric acid transporter ABCG2 expression by activating the Wnt/β-catenin pathway in HK-2 cells. HK-2 cells were transfected with NRBP1 and cultured with 21H7 (Wnt/β-catenin-inhibitor), western blot was used to analyze the expression levels of NRBP1, β-catenin, p-β-catenin, GSK3β and p-GSK3β in HK-2 cells. (χ¯±s,n=3), #P<0.05, ##P<0.01 vs. Model group, ★P<0.05, ★★P<0.01 vs. Lenti-NRBP1 group." ] ] 5 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:1 [ "tablatextoimagen" => array:1 [ 0 => array:1 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse primer \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Human NRBP1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAGGTGAATCAACGGAATGTACC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CTTGTAGTTCTTGCGTTCAGAGA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Human ABCG2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CAGGTGGAGGCAAATCTTCGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">ACCCTGTTAATCCGTTCGTTTT \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Human OAT1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTTTCGCATCTACTTACGTCCTG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCACATTAACACCAGCACAAAA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Human GLUT9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CCTCTACGGCTACAACCTGTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AGAGTGTCTGGGTCTATTGGAC \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Human URAT1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TCTCCACGTTGTGCTGGTTC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GGATGTCCACGACACCAATGA \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Human β-actin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTTGAGAACCGTGTACCATGT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">TTCCCACAATTTGGCAAGAGC \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] ] ] ] "descripcion" => array:1 [ "en" => "Primer sequence of the genes for qRT-PCR analysis (5′-3′)." ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:39 [ 0 => array:3 [ "identificador" => "bib0200" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene nrbp1 upregulates its expression by inhibition of tfap2a binding" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "Z. Zhu" 1 => "W. Meng" 2 => "P. Liu" 3 => "X. Zhu" 4 => "Y. Liu" 5 => "H. Zou" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Clin Epigenet" "fecha" => "2017" "volumen" => "9" "paginaInicial" => "99" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0205" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of the metabolic syndrome in patients with gout: the Third National Health and Nutrition Examination Survey" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "H.K. Choi" 1 => "E.S. Ford" 2 => "C. Li" 3 => "G. Curhan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Arthritis Care Res (Hoboken)" "fecha" => "2007" "volumen" => "57" "paginaInicial" => "109" "paginaFinal" => "115" ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0210" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Causal assessment of serum urate levels in cardiometabolic diseases through a mendelian randomization study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "T. Keenan" 1 => "W. Zhao" 2 => "A. Rasheed" 3 => "W.K. Ho" 4 => "R. Malik" 5 => "J.F. Felix" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.jacc.2015.10.086" "Revista" => array:6 [ "tituloSerie" => "J Am Coll Cardiol" "fecha" => "2016" "volumen" => "67" "paginaInicial" => "407" "paginaFinal" => "416" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26821629" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0215" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Plasma urate concentration and risk of coronary heart disease: a mendelian randomisation analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. White" 1 => "R. Sofat" 2 => "G. Hemani" 3 => "T. Shah" 4 => "J. Engmann" 5 => "C. Dale" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S2213-8587(15)00386-1" "Revista" => array:6 [ "tituloSerie" => "Lancet Diabetes Endocrinol" "fecha" => "2016" "volumen" => "4" "paginaInicial" => "327" "paginaFinal" => "336" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26781229" "web" => "Medline" ] ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0220" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A Mendelian randomization study of circulating uric acid and type 2 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "I. Sluijs" 1 => "M.V. Holmes" 2 => "Y.T. Van Der Schouw" 3 => "J.W.J. Beulens" 4 => "F.W. Asselbergs" 5 => "J.M. Huerta" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2337/db14-0742" "Revista" => array:6 [ "tituloSerie" => "Diabetes" "fecha" => "2015" "volumen" => "64" "paginaInicial" => "3028" "paginaFinal" => "3036" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25918230" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0225" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Uric acid and cardiovascular events: a Mendelian randomization study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.E. Kleber" 1 => "G. Delgado" 2 => "T.B. Grammer" 3 => "G. Silbernagel" 4 => "J. Huang" 5 => "B.K. Kramer" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Am Soc Nephrol" "fecha" => "2015" "volumen" => "26" "paginaInicial" => "2831" "paginaFinal" => "2838" ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0230" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hyperuricemia and cardiovascular risk" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "D. Grassi" 1 => "G. Desideri" 2 => "A.V. Di Giacomantonio" 3 => "P. Di Giosia" 4 => "C. Ferri" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s40292-014-0046-3" "Revista" => array:6 [ "tituloSerie" => "High Blood Press Cardiovasc Prev" "fecha" => "2014" "volumen" => "21" "paginaInicial" => "235" "paginaFinal" => "242" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24554489" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0235" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Contemporary epidemiology of gout in the UK general population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L.C. Soriano" 1 => "D. Rothenbacher" 2 => "H.K. Choi" 3 => "L.A. García" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/ar3272" "Revista" => array:5 [ "tituloSerie" => "Arthritis Res Ther" "fecha" => "2011" "volumen" => "13" "paginaInicial" => "R39" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21371293" "web" => "Medline" ] ] ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0240" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Epidemiology of gout and hyperuricaemia in Italy during the years 2005–2009: a nationwide population-based study" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "G. Trifir‘o" 1 => "P. Morabito" 2 => "L. Cavagna" 3 => "C. Ferrajolo" 4 => "S. Pecchioli" 5 => "M. Simonetti" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/annrheumdis-2011-201254" "Revista" => array:6 [ "tituloSerie" => "Ann Rheum Dis" "fecha" => "2013" "volumen" => "72" "paginaInicial" => "694" "paginaFinal" => "700" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22736095" "web" => "Medline" ] ] ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0245" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Prevalence of gout and hyperuricemia in the US general population: the National Health andNutrition Examination Survey 2007–2008" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "Y. Zhu" 1 => "B.J. Pandya" 2 => "H.K. Choi" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2011" "volumen" => "63" "paginaInicial" => "3136" "paginaFinal" => "3141" ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0250" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ABCG2 dysfunction causes hyperuricemia due to both renal urate underexcretion and renal urate overload" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Matsuo" 1 => "A. Nakayama" 2 => "M. Sakiyama" 3 => "T. Chiba" 4 => "S. Shimizu" 5 => "Y. Kawamura" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Sci Rep" "fecha" => "2014" "volumen" => "20" "paginaInicial" => "3755" ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0255" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Uric acid and cardiovascular disease: an update from molecular mechanism to clinical perspective" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "W. Yu" 1 => "J.D. Cheng" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fphar.2020.582680" "Revista" => array:5 [ "tituloSerie" => "Front Pharmacol" "fecha" => "2020" "volumen" => "11" "paginaInicial" => "582680" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33304270" "web" => "Medline" ] ] ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0260" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Hyperuricemia and risk of stroke: a systematic review and meta-analysis of prospective studies" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M. Li" 1 => "W. Hou" 2 => "X. Zhang" 3 => "L. Hu" 4 => "Z. Tang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.atherosclerosis.2013.11.051" "Revista" => array:6 [ "tituloSerie" => "Atherosclerosis" "fecha" => "2014" "volumen" => "232" "paginaInicial" => "265" "paginaFinal" => "270" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24468137" "web" => "Medline" ] ] ] ] ] ] ] ] 13 => array:3 [ "identificador" => "bib0265" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Renal underexcretion of uric acid is present in patients with apparent high urinary uric acid output" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "F. Perez-Ruiz" 1 => "M. Calabozo" 2 => "G. García Erauskin" 3 => "A. Ruibal" 4 => "A.M. Herrero-Beites" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/art.10792" "Revista" => array:6 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2002" "volumen" => "47" "paginaInicial" => "610" "paginaFinal" => "613" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12522834" "web" => "Medline" ] ] ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0270" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "SLC2A9 is a high-capacity urate transporter in humans" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M.J. Caulfield" 1 => "P.B. Munroe" 2 => "D. O’Neill" 3 => "K. Witkowska" 4 => "F.J. Charchar" 5 => "M. Doblado" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pmed.0050197" "Revista" => array:5 [ "tituloSerie" => "PLoS Med" "fecha" => "2008" "volumen" => "5" "paginaInicial" => "e197" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18842065" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0275" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Contribution of intestine and kidney to glucose fluxes in different nutritional states in rat" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G. Mithieux" 1 => "A. Gautier-Stein" 2 => "F. Rajas" 3 => "C. Zitoun" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cbpb.2005.11.007" "Revista" => array:6 [ "tituloSerie" => "Comp Biochem Physiol B: Biochem Mol Biol" "fecha" => "2006" "volumen" => "143" "paginaInicial" => "195" "paginaFinal" => "200" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16412674" "web" => "Medline" ] ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0280" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Urate transport via human PAH transporter hOAT1 and its gene structure" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Ichida" 1 => "M. Hosoyamada" 2 => "H. Kimura" 3 => "M. Takeda" 4 => "Y. Utsunomiya" 5 => "T. Hosoya" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1046/j.1523-1755.2003.00710.x" "Revista" => array:6 [ "tituloSerie" => "Kidney Int" "fecha" => "2003" "volumen" => "63" "paginaInicial" => "143" "paginaFinal" => "155" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12472777" "web" => "Medline" ] ] ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0285" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Maori Pacific Island, and Caucasian case-control sample sets" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.E. Hollis-Moffatt" 1 => "X. Xu" 2 => "N. Dalbeth" 3 => "M.E. Merriman" 4 => "R. Topless" 5 => "C. Waddell" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Arthritis Rheum" "fecha" => "2009" "volumen" => "60" "paginaInicial" => "3485" "paginaFinal" => "3492" ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0290" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "NRBP1 is downregulated in breast cancer and NRBP1 over expression inhibits cancer cell proliferation through Wnt/beta-catenin signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Wei" 1 => "H. Wang" 2 => "Q. Ji" 3 => "J. Sun" 4 => "L. Tao" 5 => "X. Zhou" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Onco Targets Ther" "fecha" => "2015" "volumen" => "8" "paginaInicial" => "3721" "paginaFinal" => "3730" ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0295" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nuclear receptor binding protein 1 regulates intestinal progenitor cell homeostasis and tumour formation" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "C.H. Wilson" 1 => "C. Crombie" 2 => "L. van der Weyden" 3 => "G. Poulogiannis" 4 => "A.G. Rust" 5 => "M. Pardo" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/emboj.2012.91" "Revista" => array:6 [ "tituloSerie" => "EMBO J" "fecha" => "2012" "volumen" => "31" "paginaInicial" => "2486" "paginaFinal" => "2497" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22510880" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0300" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Regulation of stem-like cancer cells by glutamine through β-catenin pathway mediated by redox signaling" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J. Liao" 1 => "P.P. Liu" 2 => "G. Hou" 3 => "J. Shao" 4 => "J. Yang" 5 => "K. Liu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12943-017-0623-x" "Revista" => array:5 [ "tituloSerie" => "Mol Cancer" "fecha" => "2017" "volumen" => "16" "paginaInicial" => "51" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28245869" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0305" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Celecoxib sensitizes imatinib-resistant K562 cells to imatinib by inhibiting MRP1-5 ABCA2 and ABCG2 transporters via Wnt and Ras signaling pathways" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "G. Dharmapuri" 1 => "R. Doneti" 2 => "G.H. Philip" 3 => "A.M. Kalle" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.leukres.2015.02.013" "Revista" => array:6 [ "tituloSerie" => "Leuk Res" "fecha" => "2015" "volumen" => "39" "paginaInicial" => "696" "paginaFinal" => "701" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25916699" "web" => "Medline" ] ] ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0310" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The WNT/β-catenin pathway is involved in the anti-adipogenic activity of cerebrosides from the sea cucumber Cucumaria frondosa" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Xu" 1 => "F. Wang" 2 => "J. Wang" 3 => "J. Xu" 4 => "Y. Wang" 5 => "C. Xue" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1039/c5fo00273g" "Revista" => array:6 [ "tituloSerie" => "Food Funct" "fecha" => "2015" "volumen" => "6" "paginaInicial" => "2396" "paginaFinal" => "2404" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26091058" "web" => "Medline" ] ] ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0315" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dihydrotestosterone regulates hair growth through the Wnt/β-catenin pathway in C57BL/6 mice and in vitro organ culture" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "X. Chen" 1 => "B. Liu" 2 => "Y. Li" 3 => "M. Wan" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.3389/fphar.2019.01528" "Revista" => array:5 [ "tituloSerie" => "Front Pharmacol" "fecha" => "2019" "volumen" => "10" "paginaInicial" => "1528" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32038233" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0320" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Anti-hyperuricemic effects of astaxanthin by regulating xanthine oxidase. Adenosine deaminase and urate transporters in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Le" 1 => "X. Zhou" 2 => "J. Zheng" 3 => "F. Yu" 4 => "Y. Tang" 5 => "Z. Yang" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:3 [ "tituloSerie" => "Mar Drugs" "fecha" => "2020" "volumen" => "18" ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0325" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Pharmacological properties and clinical efficacy of dotinurad (URECE® tablets), a novel hypouricemic agent" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "T. Taniguchi" 1 => "N. Ashizawa" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1254/fpj.20047" "Revista" => array:6 [ "tituloSerie" => "Nihon Yakurigaku Zasshi" "fecha" => "2020" "volumen" => "155" "paginaInicial" => "426" "paginaFinal" => "434" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33132262" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0330" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Dendrobium officinalis six nostrum ameliorates urate under-excretion and protects renal dysfunction in lipid emulsion-induced hyperuricemic rats" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "X. Chen" 1 => "H.Z. Ge" 2 => "S.S. Lei" 3 => "Z.T. Jiang" 4 => "J. Su" 5 => "X. He" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.biopha.2020.110765" "Revista" => array:5 [ "tituloSerie" => "Biomed Pharmacother" "fecha" => "2020" "volumen" => "132" "paginaInicial" => "110765" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33120237" "web" => "Medline" ] ] ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0335" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The association between genetic polymorphisms in ABCG2 and SLC2A9 and urate: an updated systematic review and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "T. Lukkunaprasit" 1 => "S. Rattanasiri" 2 => "S. Turongkaravee" 3 => "A. Thakkinstian" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "BMC Med Genet" "fecha" => "2020" "volumen" => "21" "paginaInicial" => "210" ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0340" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Gypenosides inhibits xanthine oxidoreductase and ameliorates urate excretion in hyperuricemic rats induced by high cholesterol and high fat food (lipid emulsion)" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Pang" 1 => "Y. Fang" 2 => "S. Chen" 3 => "X. Zhu" 4 => "C. Shan" 5 => "J. Su" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.12659/msm.903217" "Revista" => array:6 [ "tituloSerie" => "Med Sci Monit" "fecha" => "2017" "volumen" => "23" "paginaInicial" => "1129" "paginaFinal" => "1140" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28258276" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0345" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The molecular physiology of uric acid homeostasis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "A.K. Mandal" 1 => "D.B. Mount" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1146/annurev-physiol-021113-170343" "Revista" => array:6 [ "tituloSerie" => "Annu Rev Physiol" "fecha" => "2015" "volumen" => "77" "paginaInicial" => "323" "paginaFinal" => "345" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25422986" "web" => "Medline" ] ] ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0350" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Effects and mechanisms of Dendrobium officinalis Six nostrum for treatment of hyperuricemia with hyperlipidemia" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "L.F. Guo" 1 => "X. Chen" 2 => "S.S. Lei" 3 => "B. Li" 4 => "N.Y. Zhang" 5 => "H.Z. Ge" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1155/2020/2914019" "Revista" => array:5 [ "tituloSerie" => "Evid Based Complement Alternat Med" "fecha" => "2020" "volumen" => "2020" "paginaInicial" => "2914019" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32308702" "web" => "Medline" ] ] ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0355" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Siwu decoction attenuates oxonate-induced hyperuricemia and kidney inflammation in mice" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "R. Wang" 1 => "C.H. Ma" 2 => "F. Zhou" 3 => "L.D. Kong" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/S1875-5364(16)30059-0" "Revista" => array:6 [ "tituloSerie" => "Chin J Nat Med" "fecha" => "2016" "volumen" => "14" "paginaInicial" => "499" "paginaFinal" => "507" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27507200" "web" => "Medline" ] ] ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0360" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Study on anti-trioxypurine effect and mechanism of dendrobium candidum simiao prescription on hyperuricemia rats" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Q. Shen" 1 => "H. Li" 2 => "S.S. Lei" 3 => "S.P. Jiang" 4 => "B. Li" 5 => "X. Zheng" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Chin J Mod Appl Pharm" "fecha" => "2019" "volumen" => "36" "paginaInicial" => "157" "paginaFinal" => "163" ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0365" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Decreased extra-renal urate excretion is a common cause of hyperuricemia" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Ichida" 1 => "H. Matsuo" 2 => "T. Takada" 3 => "A. Nakayama" 4 => "K. Murakami" 5 => "T. Shimizu" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ncomms1756" "Revista" => array:5 [ "tituloSerie" => "Nat Commun" "fecha" => "2012" "volumen" => "3" "paginaInicial" => "764" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22473008" "web" => "Medline" ] ] ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0370" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Study on mechanism of compound qiling formula granules in treatment of hyperuricemia in rats" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "Y. Zhang" 1 => "H. Xu" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Chin J Mod Appl Pharm" "fecha" => "2020" "volumen" => "37" "paginaInicial" => "1825" "paginaFinal" => "1829" ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0375" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Nuclear receptor-binding protein 1: a novel tumour suppressor and pseudokinase" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "J.S. Kerr" 1 => "C.H. Wilson" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1042/BST20130069" "Revista" => array:6 [ "tituloSerie" => "Biochem Soc Trans" "fecha" => "2013" "volumen" => "41" "paginaInicial" => "1055" "paginaFinal" => "1060" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23863178" "web" => "Medline" ] ] ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0380" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "NRBP1 is downregulated in breast cancer and NRBP1 overexpression inhibits cancer cell proliferation through Wnt/β-catenin signaling pathway" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "H. Wei" 1 => "H. Wang" 2 => "Q. Ji" 3 => "J. Sun" 4 => "L. Tao" 5 => "X. Zhou" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Onco Targets Ther" "fecha" => "2015" "volumen" => "8" "paginaInicial" => "3721" "paginaFinal" => "3730" ] ] ] ] ] ] 37 => array:3 [ "identificador" => "bib0385" "etiqueta" => "38" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "ABCB1 and ABCG2 drug transporters are differentially expressed in non-small cell lung cancers (NSCLC) and expression is modified by cisplatin treatment via altered Wnt signaling" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Vesel" 1 => "J. Rapp" 2 => "D. Feller" 3 => "E. Kiss" 4 => "L. Jaromi" 5 => "M. Meggyes" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/s12931-017-0537-6" "Revista" => array:5 [ "tituloSerie" => "Respir Res" "fecha" => "2017" "volumen" => "18" "paginaInicial" => "52" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28340578" "web" => "Medline" ] ] ] ] ] ] ] ] 38 => array:3 [ "identificador" => "bib0390" "etiqueta" => "39" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Blockade of ERK1/2 by U0126 alleviates uric acid-induced EMT and tubular cell injury in rats with hyperuricemic nephropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "M. Tao" 1 => "Y. Shi" 2 => "L. Tang" 3 => "Y. Wang" 4 => "L. Fang" 5 => "W. Jiang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1152/ajprenal.00480.2018" "Revista" => array:6 [ "tituloSerie" => "Am J Physiol Renal Physiol" "fecha" => "2019" "volumen" => "316" "paginaInicial" => "F660" "paginaFinal" => "F673" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30648910" "web" => "Medline" ] ] ] ] ] ] ] ] ] ] ] ] ] "idiomaDefecto" => "en" "url" => "/02116995/0000004300000002/v1_202303240922/S0211699521002332/v1_202303240922/en/main.assets" "Apartado" => array:4 [ "identificador" => "42448" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/02116995/0000004300000002/v1_202303240922/S0211699521002332/v1_202303240922/en/main.pdf?idApp=UINPBA000064&text.app=https://revistanefrologia.com/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699521002332?idApp=UINPBA000064"]

Estadísticas

Original article

NRBP1 modulates uric acid transporter ABCG2 expression by activating the Wnt/β-catenin pathway in HK-2 cells

NRBP1 regula la expresión del transportador de ácido úrico ABCG2 en las células HK-2 mediante la activación de la vía Wnt/β-catenina

Qiankun Zhanga, Hang Fanga,b, Zaihua Zhuc,

Autor para correspondencia

qiankunzhangphd@126.com

Corresponding author.

a Division of Nephrology, Lishui Central Hospital and Fifth Affiliated Hospital of Wenzhou Medical College, Lishui 323000, China

b Institute of Nephrology, Zhejiang University, Hangzhou 310003, China

c Division of Rheumatology and Immunology, Huashan Hospital Fudan University, Shanghai 200000, China

Leído

6837

Veces
se ha leído el artículo

2545

Total PDF

4292

Total HTML

Compartir estadísticas

 array:24 [
  "pii" => "S0211699521002332"
  "issn" => "02116995"
  "doi" => "10.1016/j.nefro.2021.09.010"
  "estado" => "S300"
  "fechaPublicacion" => "2023-03-01"
  "aid" => "984"
  "copyright" => "Sociedad Espa&#241;ola de Nefrolog&#237;a"
  "copyrightAnyo" => "2021"
  "documento" => "article"
  "crossmark" => 0
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Nefrologia. 2023;43:204-12"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:19 [
    "pii" => "S0211699521002368"
    "issn" => "02116995"
    "doi" => "10.1016/j.nefro.2021.10.001"
    "estado" => "S300"
    "fechaPublicacion" => "2023-03-01"
    "aid" => "987"
    "copyright" => "Sociedad Espa&#241;ola de Nefrolog&#237;a"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Nefrologia. 2023;43:213-23"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Low dose thymoglobulin versus basiliximab in cytomegalovirus positive kidney transplant recipients&#58; Effectiveness of preemptive cytomegalovirus modified strategy"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "213"
          "paginaFinal" => "223"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Timoglobulina en dosis bajas vs&#46; basiliximab en receptores de trasplante renal positivos para citomegalovirus&#58; efectividad de una estrategia preventiva modificada"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0015"
          "etiqueta" => "Fig&#46; 3"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr3.jpeg"
              "Alto" => 1579
              "Ancho" => 1508
              "Tamanyo" => 73049
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">Viremia onset and duration distributions according to induction type&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Camilo Montero, Nancy Yomayusa, Rodolfo Torres, Jorge Cortes, Carlos Alvarez, Juan Gallo, Guillermo Aldana, Andres Acevedo, Maria Rios, Johana Echeverri, Zuly Yepes, Adriana Silva, Diana Gayon, Jorge Perez, Milciades Ibanez"
          "autores" => array:15 [
            0 => array:2 [
              "nombre" => "Camilo"
              "apellidos" => "Montero"
            ]
            1 => array:2 [
              "nombre" => "Nancy"
              "apellidos" => "Yomayusa"
            ]
            2 => array:2 [
              "nombre" => "Rodolfo"
              "apellidos" => "Torres"
            ]
            3 => array:2 [
              "nombre" => "Jorge"
              "apellidos" => "Cortes"
            ]
            4 => array:2 [
              "nombre" => "Carlos"
              "apellidos" => "Alvarez"
            ]
            5 => array:2 [
              "nombre" => "Juan"
              "apellidos" => "Gallo"
            ]
            6 => array:2 [
              "nombre" => "Guillermo"
              "apellidos" => "Aldana"
            ]
            7 => array:2 [
              "nombre" => "Andres"
              "apellidos" => "Acevedo"
            ]
            8 => array:2 [
              "nombre" => "Maria"
              "apellidos" => "Rios"
            ]
            9 => array:2 [
              "nombre" => "Johana"
              "apellidos" => "Echeverri"
            ]
            10 => array:2 [
              "nombre" => "Zuly"
              "apellidos" => "Yepes"
            ]
            11 => array:2 [
              "nombre" => "Adriana"
              "apellidos" => "Silva"
            ]
            12 => array:2 [
              "nombre" => "Diana"
              "apellidos" => "Gayon"
            ]
            13 => array:2 [
              "nombre" => "Jorge"
              "apellidos" => "Perez"
            ]
            14 => array:2 [
              "nombre" => "Milciades"
              "apellidos" => "Ibanez"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699521002368?idApp=UINPBA000064"
    "url" => "/02116995/0000004300000002/v1_202303240922/S0211699521002368/v1_202303240922/en/main.assets"
  ]
  "itemAnterior" => array:19 [
    "pii" => "S0211699521002319"
    "issn" => "02116995"
    "doi" => "10.1016/j.nefro.2021.09.009"
    "estado" => "S300"
    "fechaPublicacion" => "2023-03-01"
    "aid" => "982"
    "copyright" => "Sociedad Espa&#241;ola de Nefrolog&#237;a"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Nefrologia. 2023;43:197-203"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
      "titulo" => "Etelcalcetide controls secondary hyperparathyroidism and raises sclerostin levels in hemodialysis patients previously uncontrolled with cinacalcet"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "197"
          "paginaFinal" => "203"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Etelcalcetida controla el hiperparatiroidismo secundario y eleva los niveles de esclerostina en pacientes en hemodi&#225;lisis previamente no controlados con cinacalcet"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Fig&#46; 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1942
              "Ancho" => 1583
              "Tamanyo" => 108549
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Plasma sclerostin levels at baseline and after 6 months of etelcalcetide treatment&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Luciano Artur Lopes Pereira, Catarina Meng, Manuel Augusto Gon&#231;alves Amoedo, Maria Teresa de Sousa Costa Pinto Ferreira Mendes, Marco Alexandre Mateus Prazeres Marques, Jo&#227;o Miguel Machado D&#243;ria Fraz&#227;o, Andr&#233; Luiz Loureiro Weigert"
          "autores" => array:7 [
            0 => array:2 [
              "nombre" => "Luciano Artur Lopes"
              "apellidos" => "Pereira"
            ]
            1 => array:2 [
              "nombre" => "Catarina"
              "apellidos" => "Meng"
            ]
            2 => array:2 [
              "nombre" => "Manuel Augusto Gon&#231;alves"
              "apellidos" => "Amoedo"
            ]
            3 => array:2 [
              "nombre" => "Maria Teresa de Sousa Costa Pinto Ferreira"
              "apellidos" => "Mendes"
            ]
            4 => array:2 [
              "nombre" => "Marco Alexandre Mateus Prazeres"
              "apellidos" => "Marques"
            ]
            5 => array:2 [
              "nombre" => "Jo&#227;o Miguel Machado D&#243;ria"
              "apellidos" => "Fraz&#227;o"
            ]
            6 => array:2 [
              "nombre" => "Andr&#233; Luiz Loureiro"
              "apellidos" => "Weigert"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699521002319?idApp=UINPBA000064"
    "url" => "/02116995/0000004300000002/v1_202303240922/S0211699521002319/v1_202303240922/en/main.assets"
  ]
  "en" => array:19 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "NRBP1 modulates uric acid transporter ABCG2 expression by activating the Wnt&#47;&#946;-catenin pathway in HK-2 cells"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "204"
        "paginaFinal" => "212"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Qiankun Zhang, Hang Fang, Zaihua Zhu"
        "autores" => array:3 [
          0 => array:3 [
            "nombre" => "Qiankun"
            "apellidos" => "Zhang"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Hang"
            "apellidos" => "Fang"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          2 => array:4 [
            "nombre" => "Zaihua"
            "apellidos" => "Zhu"
            "email" => array:1 [
              0 => "qiankunzhangphd@126.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:3 [
          0 => array:3 [
            "entidad" => "Division of Nephrology&#44; Lishui Central Hospital and Fifth Affiliated Hospital of Wenzhou Medical College&#44; Lishui 323000&#44; China"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Institute of Nephrology&#44; Zhejiang University&#44; Hangzhou 310003&#44; China"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Division of Rheumatology and Immunology&#44; Huashan Hospital Fudan University&#44; Shanghai 200000&#44; China"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "<span class="elsevierStyleItalic">Corresponding author</span>&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "NRBP1 regula la expresi&#243;n del transportador de &#225;cido &#250;rico ABCG2 en las c&#233;lulas HK-2 mediante la activaci&#243;n de la v&#237;a Wnt&#47;&#946;-catenina"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1046
            "Ancho" => 3333
            "Tamanyo" => 187178
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Effect of NRBP1 knockdown or overexpression on the Wnt&#47;&#946;-catenin signaling pathway in HK-2 cells&#46; A&#44; Western blot was used to analyze the expression levels of &#946;-catenin&#44; p-&#946;-catenin&#44; GSK3&#946; and p-GSK3&#946; in stably si-NRBP1-transfected or NRBP-1 overexpression HK-2 cells&#46; B&#8211;C&#44; Semi-quantification of the expression levels of proteins in parts A&#46; &#40;&#967;&#175;&#177;s&#44;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#41;&#44; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Control group&#44; <span class="elsevierStyleSup">&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; <span class="elsevierStyleSup">&#35;&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Model group&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0065">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Gout is a serious health issue with a prevalence of 1&#46;14&#37; in adults in China&#44;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">1</span></a> and is an independent risk factor for heart failure and metabolic syndrome&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">2</span></a> It is associated with many conditions that affect longevity&#44; such as hypertension&#44; diabetes mellitus&#44; metabolic syndrome&#44; and renal and cardiovascular disease&#46;<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">3&#8211;6</span></a> Hyperuricemia is considered to be a precursor of gout as the deposition of urate crystals in the joints and soft tissue results in an acute inflammatory response and tophi&#44; respectively&#46;<a class="elsevierStyleCrossRefs" href="#bib0230"><span class="elsevierStyleSup">7&#44;8</span></a> In recent years&#44; the trend in the prevalence of gout and hyperuricemia have been observed increased in epidemiological studies&#44;<a class="elsevierStyleCrossRefs" href="#bib0240"><span class="elsevierStyleSup">9&#44;10</span></a> and the diseases have become public health problems that need to be solved quickly&#46;</p><p id="par0010" class="elsevierStylePara elsevierViewall">Generally&#44; hyperuricemia has been classified into urate &#8216;overproduction type&#8217; and&#47;or &#8216;underexcretion type&#8217; based solely on renal urate excretion&#44; without considering an extra-renal pathway&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">11</span></a> Uric acid is principally derived from purine metabolism&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">12</span></a> And hyperuricemia was caused by metabolism abnormalities of serum uric acid&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">13</span></a> In humans&#44; kidney plays a pivotal role in urate handling&#44; the mechanism is to maintain the balance between secretory and efficient reabsorption&#46;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">14</span></a> The reduction of glomerular filtration&#44; increased tubular resorption&#44; and decreased tubular secretion of uric acid all induced the impairment of renal excretion of uric acid&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">15</span></a> The excretion of uric acid in the kidney is assisted by uric acid transporters&#44; which have uric acid reabsorption transporters and uric acid secretion transporters&#46; The renal proximal nephron plays a major role in the reabsorption of glucose from the urine using a combination of sodium-coupled hexose transporters&#44; urate transporter 1 &#40;URAT1&#44; SLC22A12&#41; and glucose transporter 9 &#40;GLUT9&#44; SLC2A9&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">16</span></a> At the same time&#44; the transporters of ATP-binding cassette subfamily G member 2 &#40;ABCG2&#41; and organic anion transporter 1 &#40;OAT1&#44; SLC22A6&#41; play major roles in the uric acid secretion&#46;<a class="elsevierStyleCrossRefs" href="#bib0280"><span class="elsevierStyleSup">17&#44;18</span></a></p><p id="par0015" class="elsevierStylePara elsevierViewall">Dozens of loci associated with gout were identified by genome-wide association studies&#44; and nuclear receptor binding protein 1 &#40;NRBP1&#41; is one of the risk genes&#46; At the same time&#44; it has been confirmed that the expression of NRBP1 was elevated in human peripheral blood mononuclear cells from gout patients&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">1</span></a> Previous studies suggested that NRBP1 can inhibit the proliferation of tumor cells by activating Wnt&#47;&#946;-catenin signaling pathways&#46;<a class="elsevierStyleCrossRefs" href="#bib0290"><span class="elsevierStyleSup">19&#44;20</span></a> Several studies have also found that the activation of Wnt&#47;&#946;-catenin signaling pathway can lead to the expression of uric acid transporter ABCG2 decrease&#46;<a class="elsevierStyleCrossRefs" href="#bib0300"><span class="elsevierStyleSup">21&#44;22</span></a> ABCG2&#44; as the most important uric acid transporter&#44; is mainly distributed in the proximal renal tubule of the kidney&#44; and its decreased expression is the pathophysiological basis for the occurrence of hyperuricemia and gout&#46; Therefore&#44; we hypothesized that NRBP1 could induce the expression of uric acid transporters ABCG2 decrease in the renal proximal nephron by activating the Wnt&#47;&#946;-catenin signaling pathway&#44; to further induce the hyperuricemia&#46;</p><p id="par0020" class="elsevierStylePara elsevierViewall">In this study&#44; we used the overexpression and knockdown of NRBP1 in the HK-2 cells to evaluate its effect on the uric acid transporter&#46; In addition&#44; the effects of blocking Wnt&#47;&#946;-catenin signaling pathways on NRBP1 mediated ABCG2 expression were also investigated&#46; According to our observations&#44; the overexpression of NRBP1 induced the expression of ABCG2&#44; which promotes uric acid reabsorption and inhibits uric acid secretion&#46; And the inhibition of NRBP1 on the expression of ABCG2 was by activating the Wnt&#47;&#946;-catenin pathway in HK-2 cells&#46; This finding will help pinpoint the causes of hyperuricemia more accurately and provide a more effective therapeutic strategy for hyperuricemia and gout&#44; leading to a good model of personalized medicine for common diseases&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0070">Materials and methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Cells culture</span><p id="par0025" class="elsevierStylePara elsevierViewall">Human renal proximal tubular epithelial cells &#40;HK-2 cells&#41; were purchased from the Shanghai Baiye Biotechnology Center &#40;China&#41;&#46; HK-2 cells were cultured in DMEM medium &#40;HyClone&#44; USA&#41; containing 10&#37; fetal bovine serum &#40;Zhejiang Tianhang Biotechnology Co&#46; Ltd&#46;&#44; China&#41; at 37<span class="elsevierStyleHsp" style=""></span>&#176;C in a humidified 5&#37; CO<span class="elsevierStyleInf">2</span> air atmosphere&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Lentivirus infections</span><p id="par0030" class="elsevierStylePara elsevierViewall">The lentivirus encoding the human NRBP1 gene and green fluorescent proteins &#40;GFP&#41; were purchased from Shanghai GenePharma Co Ltd&#44; China&#46; The target cells were infected with the lentivirus according to the manufacturers&#8217; instructions&#46; The transfection effect 72<span class="elsevierStyleHsp" style=""></span>h after infection was observed by fluorescence microscope camera&#44; and the expression of NBRP1 was confirmed by western blot&#46;</p></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">RNA interference</span><p id="par0035" class="elsevierStylePara elsevierViewall">One short interfering RNA &#40;siRNA&#41; targeting the NRBP1 sequence &#40;siNRBP1&#58; GTCGAGAAGAGCAGAAGAA&#41; was synthesized&#46; siRNA targeting NRBP1 or scrambled siRNA &#40;negative control&#44; siCONT&#41; were transfected using Lipofectamine RNAiMAX transfection reagent &#40;Invitrogen&#44; Carlsbad&#44; CA&#44; USA&#41; to knock down endogenous NRBP1&#46; Total protein was collected from cells to analyze NRBP1 silencing efficiency&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Treatment of HK-2 cells</span><p id="par0040" class="elsevierStylePara elsevierViewall">After the confirmation of NRBP1 overexpression and knockdown efficiency&#44; HK-2 cells were assigned into 4 groups&#58; control group &#40;HK-2 cells cultured in normal DMEM medium&#41;&#44; model group &#40;HK-2 cells cultured in DMEM medium contain 400<span class="elsevierStyleHsp" style=""></span>&#956;mol&#47;L uric acid&#41;&#44; Lenti-NRBP1 group &#40;HK-2 cells infected with the NRBP1 lentivirus and cultured in normal DMEM medium&#41;&#44; and si-NRBP1 group &#40;HK-2 cells were transfected by NRBP1 siRNA and cultured in DMEM medium contain 400<span class="elsevierStyleHsp" style=""></span>&#956;mol&#47;L uric acid&#41;&#46; After 48<span class="elsevierStyleHsp" style=""></span>h of co-cultured&#44; the further experiment was performed&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Quantitative real-time polymerase chain reaction &#40;qRT-PCR&#41;</span><p id="par0045" class="elsevierStylePara elsevierViewall">In order to determine the effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid&#44; the mRNAs expression of ABCG2&#44; OAT1&#44; GLUT9 and URAT1 were detected by qRT-PCR&#46; Total RNA was extracted from each group using Trizol reagent &#40;Bioengineering Company Limited&#44; China&#41; according to the manufacturer&#39;s instructions&#46; Then it was reverse transcription to cDNA&#44; amplified and analyzed using SYBR Green PCR Master Mix &#40;Kangwei Century Biotechnology Co&#46; Ltd&#44; China&#41; and a CFX96 real-time system &#40;Bio-Rad&#44; USA&#41;&#46; Each group was analyzed in triplicate&#46; The original threshold cycle &#40;Ct&#41; values were standardized with &#946;-actin by the 2<span class="elsevierStyleSup">&#8722;&#916;&#916;Ct</span> method&#46; The primer sequences used are shown in <a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Immunofluorescence &#40;IF&#41; staining</span><p id="par0050" class="elsevierStylePara elsevierViewall">To determine the cellular location of ABCG2 and its expression after NRBP1 overexpression and knockdoen&#44; IF staining was performed&#46; The treated HK-2 cells were fixed using 4&#37; paraformaldehyde for 10<span class="elsevierStyleHsp" style=""></span>min&#44; washed with PBS three times&#44; and permeabilized with 0&#46;5&#37; Triton X-100 &#40;Sigma&#44; St&#46; Louis&#44; MO&#44; USA&#41; for an additional 2<span class="elsevierStyleHsp" style=""></span>min&#46; After blocking with 3&#37; bovine serum albumin &#40;BSA&#41; for 0&#46;5<span class="elsevierStyleHsp" style=""></span>h&#44; ABCG2 was detected using mouse anti-human ABCG2 mAb &#40;1&#58;100&#44; ab229193&#44; abcam&#44; USA&#41; overnight&#46; After washing&#44; the cells were incubated with secondary antibody at room temperature&#46; Finally&#44; the cellular nuclei were stained by DAPI &#40;40&#44;6-diamidino-2-phenylindole&#41; &#40;Sigma&#44; USA&#41;&#46; The samples were observed under a fluorescence microscope &#40;Nikon&#44; Japan&#41;&#46; The ImageJ software was used to quantify the fluorescence density&#46;</p></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Protein extraction and western blot</span><p id="par0055" class="elsevierStylePara elsevierViewall">The efficiency of NRBP1 overexpression and knockdown&#44; effects of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid and Wnt&#47;&#946;-catenin signal pathway were all detected by western blot&#46; Cellular protein was extracted from the cells transfected with or without siNRBP1 using RIPA lysis buffer &#40;Beyotime Biotechnology&#44; China&#41;&#46; The protein concentration was detected using the bicinchoninic acid &#40;BCA&#41; protein quantification kit &#40;Solarbio&#44; Beijing&#44; China&#41;&#46; Equivalent amounts of protein were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis &#40;SDS-PAGE&#41; and subsequently transferred to polyvinylidene fluoride &#40;PVDF&#41; membranes&#46; Then the protein blots were incubated with primary antibodies overnight at 4<span class="elsevierStyleHsp" style=""></span>&#176;C&#46; After washing three times with TBST buffer and the protein blots were incubated with secondary antibody at room temperature for 1&#8211;2<span class="elsevierStyleHsp" style=""></span>h&#46; The reactive bands were visualized by use of the ECL-Plus reagent &#40;Solarbio&#44; Beijing&#44; China&#41;&#46; The density of band was quantified by the Quantity One analytic software&#46; The primary antibodies including anti-beta Actin antibody &#40;1&#58;1000&#44; ab8227&#44; Abcam&#44; USA&#41;&#44; NRBP1 antibody &#40;1&#58;1000&#44; DF10146&#44; Affinity&#44; USA&#41;&#44; ABCG2 antibody &#40;1&#58;500&#44; AF5177&#44; Affinity&#44; USA&#41;&#44; Anti-SLC22A6 antibody &#40;1&#58;500&#44; ab135924&#44; Abcam&#44; USA&#41;&#44; Anti-GLUT9 antibody &#40;1&#58;500&#44; ab223470&#44; Abcam&#44; USA&#41;&#44; URAT1antibody &#40;1&#58;500&#44; DF12340&#44; Affinity&#44; USA&#41;&#44; Anti-beta Catenin antibody &#40;0&#46;25<span class="elsevierStyleHsp" style=""></span>&#956;g&#47;mL&#44; ab16051&#44; Abcam&#44; USA&#41;&#44; GSK3 beta antibody &#40;1&#58;500&#44; ab53050&#44; Affinity&#44; USA&#41; and GSK3 beta antibody &#40;1&#58;500&#44; ab53050&#44; Affinity&#44; USA&#41;&#46;</p></span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">21H7 treatment</span><p id="par0060" class="elsevierStylePara elsevierViewall">21H7 is a selective inhibitor of the Wnt&#47;&#946;-catenin pathway that destabilizes &#946;-catenin&#46;<a class="elsevierStyleCrossRef" href="#bib0310"><span class="elsevierStyleSup">23</span></a> The HK-2 cells were divided into four group&#58; model group&#44; model<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>21H7 group&#44; Lenti-NRBP1 group and Lenti-NRBP1<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>21H7 group&#46; After transfection with NRBP1 lentivirus&#44; HK-2 cells were treated with or without 21H7 &#40;4<span class="elsevierStyleHsp" style=""></span>&#956;M&#44; Sigma-Aldrich&#44; USA&#41; for 48<span class="elsevierStyleHsp" style=""></span>h&#46;<a class="elsevierStyleCrossRef" href="#bib0315"><span class="elsevierStyleSup">24</span></a> After that&#44; the proteins expression of NRBP1&#44; ABCG2&#44; &#946;-catenin&#44; p-&#946;-catenin&#44; GSK-3&#946; and p-GSK-3&#946; were detected by western blot&#46;</p></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Statistical analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">The statistical analyses were performed using SPSS 16&#46;0 &#40;IBM&#44; Armonk&#44; NY&#44; USA&#41;&#46; Values are expressed as &#967;&#175;&#177;s&#46; Comparisons of multiple independent groups were analyzed using One-way ANOVA followed SNK post hoc test&#46; In all cases&#44; <span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 was considered as statistical significance&#46;</p></span></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Results</span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Efficiency of NRBP1 transfection and knockdown</span><p id="par0070" class="elsevierStylePara elsevierViewall">Lentivirus system was used to generate stable NRBP1 overexpression in HK-2 cells&#46; Western blot analysis showed that NRBP1 protein expression was significantly elevated in HK-2 cells transduced with Lenti-NRBP1 &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#44; <a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46; At the same time&#44; plasmids carrying a NRBP1 siRNA was generated to knockdown NRBP1 expression in HK-2 cells&#46; A reduced protein level of NRBP1 in HK-2 cells transduced with NRBP1 siRNA was verified by western blot &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; Taken together&#44; the efficiency of NRBP1 transfection and silencing were significant&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid</span><p id="par0075" class="elsevierStylePara elsevierViewall">The mRNAs and proteins related to the secretion and reabsorption of uric acid such as ABCG2&#44; OAT1&#44; GLUT9 and URAT1 were detected by qRT-PCR and western blot&#46; Compared with control group&#44; the mRNAs and proteins expression of NRBP1&#44; GLUT9 and URAT1 were significantly increased in model and si-NRBP1 group&#44; while ABCG2 and OAT1 were decreased in model group &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; <a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46; Compared with model group&#44; the mRNAs and proteins expression of GLUT9 and URAT1 was decreased significantly in Lenti-NRBP1 group &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; At the same time&#44; the mRNAs and proteins expression of ABCG2 and NRBP1 in si-NRBP1 were significantly increased and decreased&#44; respectively &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; Therefore&#44; ABCG2 might be the target of NRBP1 for the treatment of hyperuricemia&#46;</p><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">NRBP1 inhibited ABCG2 expression in the HK-2 cells</span><p id="par0080" class="elsevierStylePara elsevierViewall">Because NRBP1 is a gout risk gene&#44; we hypothesized that NRBP1 could regulate the ABCG2 mRNA and protein expression in proximal tubular epithelial cells&#44; and then affect renal urate excretion&#46; According to IF results &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#44; NRBP1 overexpression inhibited the expression of ABCG2 in HK-2 cells &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; Compared with model group&#44; the expression of ABCG2 was significantly increased in the si-NRBP1 group &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; The results provided compelling evidence regarding the inhibition effects of NRBP1 on the protein expression of ABCG2&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Effect of NRBP1 knockdown or overexpression on the Wnt&#47;&#946;-catenin signaling pathway in HK-2 cells</span><p id="par0085" class="elsevierStylePara elsevierViewall">According to the western blot results &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#41;&#44; the ratio of p-&#946;-catenin&#47;&#946;-catenin was significantly upregulated in siNRBP1-transfected HK-2 cells compared with the model group &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; However&#44; the ratio of p-GSK3&#946;&#47;GSK3&#946; was significantly downregulated in siNRBP1-transfected HK-2 cells compared with the model group &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#46; In contrast&#44; the ratio of p-GSK3&#946;&#47;GSK3&#946; in stable NRBP1 overexpressing HK-2 cells was significantly upregulated &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#44; while the ratio of p-&#946;-catenin&#47;&#946;-catenin was significantly downregulated &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#44; compared with the control group&#46; Taken together&#44; these findings suggested that NRBP1 may have a regulating role in the progression of renal urate excretion by activating the Wnt&#47;&#946;-catenin signaling pathway&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Effect of blocking Wnt&#47;&#946;-catenin pathway on NRBP1 mediated ABCG2 expression</span><p id="par0090" class="elsevierStylePara elsevierViewall">In order to further explored the effect of the Wnt&#47;&#946;-catenin pathway on NRBP1 mediated ABCG2 expression&#44; the proteins expression of NRBP1&#44; &#946;-catenin&#44; p-&#946;-catenin&#44; GSK-3&#946;&#44; p-GSK-3&#946; and ABCG2 in HK-2 cells was performed by western blot after treated with the Wnt&#47;&#946;-catenin inhibitor 21H7&#46; As shown in the <a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>&#44; in the model<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>21H7 and Lenti-NRBP1<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>21H7 group HK-2 cells&#44; the ratio of p-&#946;-catenin&#47;&#946;-catenin and ABCG2 expression was markedly elevated &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41;&#44; while the ratio of p-GSK-3&#946;&#47;GSK-3&#946; was markedly decreased &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01&#41; compared with model and Lenti-NRBP1 group HK-2 cells&#46; In addition&#44; there was no influence on the protein expression of NRBP1 after blocked the Wnt&#47;&#946;-catenin pathway both in model and Lenti-NRBP1 group &#40;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46; These results suggested that NRBP1 modulates uric acid transporter ABCG2 expression by activating the Wnt&#47;&#946;-catenin pathway in HK-2 cells&#46;</p><elsevierMultimedia ident="fig0025"></elsevierMultimedia></span></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Discussion</span><p id="par0095" class="elsevierStylePara elsevierViewall">At present&#44; the classification of hyperuricemia is based on the understanding of its mechanism by which hyperuricemia results from either overproduction of urate due to a metabolism disorder&#44; underexcretion by abnormal renal urate transport activity&#44; or the combination of both&#46;<a class="elsevierStyleCrossRefs" href="#bib0320"><span class="elsevierStyleSup">25&#44;26</span></a> The main cause of hyperuricemia is &#8216;renal urate underexcretion&#8217;&#44; and &#8216;urate overproduction&#8217; is considered as another common cause&#46;<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">27&#44;28</span></a> In the body&#44; about 2&#47;3 of urate is excreted by the kidney&#44; while the other 1&#47;3 of urate is excreted from the intestine into feces and broken down by colonic bacteria&#46;<a class="elsevierStyleCrossRef" href="#bib0340"><span class="elsevierStyleSup">29</span></a> Therefore&#44; to improving uric acid excretion or inhibiting uric acid reabsorption via the kidney to reduce the level of uric acid might be a main effective approach to the prevention and treatment of gout and hyperuricemia&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">A number of urate transport in the kidney regulate urate excretion and reabsorption to control uric acid balance in the blood&#46;<a class="elsevierStyleCrossRef" href="#bib0345"><span class="elsevierStyleSup">30</span></a> Among them&#44; URAT1 and GLUT9 regulate uric acid reabsorption&#44; while ABCG2 and OAT1 regulate urate excretion&#46;<a class="elsevierStyleCrossRefs" href="#bib0350"><span class="elsevierStyleSup">31&#44;32</span></a> The dysregulation of these urate transporters alters urate control in the body&#44; increasing the risk for hyperuricemia&#46;<a class="elsevierStyleCrossRefs" href="#bib0330"><span class="elsevierStyleSup">27&#44;33</span></a> At present&#44; the common dysfunctional variants of ABCG2 decrease extra-renal urate excretion including gut excretion and cause hyperuricemia&#46;<a class="elsevierStyleCrossRefs" href="#bib0365"><span class="elsevierStyleSup">34&#44;35</span></a></p><p id="par0105" class="elsevierStylePara elsevierViewall">NRBP1 is a gout risk gene&#46; In previous study&#44; the hypomethylation at the promoter region of NRBP1 reduces the binding of TFAP2A and thus leads to elevated NRBP1 expression&#44; which contribute to the development of gout&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">18</span></a> Before this&#44; it has been showed that NRBP1 plays an important role in tumor suppression&#44; cellular homoeostasis&#44; and protein regulation by regulating the Wnt&#47;&#946;-catenin signaling pathway&#46;<a class="elsevierStyleCrossRefs" href="#bib0375"><span class="elsevierStyleSup">36&#44;37</span></a> Meanwhile&#44; the urate transporters ABCG2 was regulated by Wnt&#47;&#946;-catenin signaling pathway&#46;<a class="elsevierStyleCrossRef" href="#bib0385"><span class="elsevierStyleSup">38</span></a> Interestingly&#44; we found that HK-2 cells which overexpressed NRBP1 or NRBP1 knockdown can regulate the expression of ABCG2&#46; However&#44; the expression of NRBP1 had no significant effect on the expression of another urate transporters OAT1&#46; In addition&#44; compared with model group&#44; the overexpression of NRBP1 also decreased the expression of GLUT9 and URAT1&#44; but the NRBP1 knockdown had no significant effect on the expression of GLUT9 and URAT1&#46; Therefore&#44; we thought that NRBP1 overexpression decreased the expression of ABCG2 resulted in the accumulation of uric acid&#44; further to induced gout or hyperuricemia&#44; and illustrated that the uric acid transporter ABCG2 might be the target of NRBP1&#46;</p><p id="par0110" class="elsevierStylePara elsevierViewall">Therefore&#44; we further explored whether the Wnt&#47;&#946;-catenin signaling pathway was involved in the regulation of NRBP1 on the expression ABCG2&#46; In previous study has shown that NRBP1 was downregulated in breast cancer and its overexpression inhibits cancer cell proliferation through Wnt&#47;&#946;-catenin signaling pathway&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">19</span></a> Wnt&#47;&#946;-catenin signaling pathway also plays an important role in hyperuricemia nephropathy&#46; The inactivation of the Wnt&#47;&#946;-catenin signaling pathway could induce the blockade of ERK1&#47;2&#44; and the inhibition of ERK1&#47;2 could have therapeutic potential for treatment of hyperuricemic nephropathy&#46;<a class="elsevierStyleCrossRef" href="#bib0390"><span class="elsevierStyleSup">39</span></a> In this study&#44; the ratio of proteins related to the Wnt&#47;&#946;-catenin signaling pathway&#44; including p-&#946;-catenin&#47;&#946;-catenin and p-GSK-3&#946;&#47;GSK-3&#946;&#44; were downregulated and upregulated respectively following NRBP1 overexpression&#44; indicating that the Wnt&#47;&#946;-catenin signaling pathway may be activated&#46; In contrast&#44; following the knockdown of NRBP1&#44; the ratio p-GSK3&#946;&#47;GSK3&#946; was significantly downregulated in HK-2 cells&#44; while the ratio p-&#946;-catenin&#47;&#946;-catenin was upregulated&#44; suggesting that the Wnt&#47;&#946;-catenin signaling pathway may be inhibited&#46;</p><p id="par0115" class="elsevierStylePara elsevierViewall">In addition&#44; the inhibitor of &#946;-catenin 21H7 was used to further explored the role of the Wnt&#47;&#946;-catenin signaling pathway in NRBP1 modulates uric acid transporter ABCG2 expression&#46; In the model and Lenti-NRBP1 HK-2 cells&#44; the addition of the &#946;-catenin inhibitor 21H7 didn&#8217;t affect the expression of NRBP1&#44; but increased the expression of ABCG2 and the ratio of p-&#946;-catenin&#47;&#946;-catenin&#46; Meanwhile&#44; the ratio of p-GSK-3&#946;&#47;GSK-3&#946; was significant&#46; Thus&#44; these results indicated that NRBP1 may serve a role in modulates uric acid transporter ABCG2 expression by activating the Wnt&#47;&#946;-catenin signaling pathway&#46;</p><p id="par0120" class="elsevierStylePara elsevierViewall">In conclusion&#44; NRBP1 can inhibit the development of hyperuricemia by mediating the expression of ABCG2 to promote uric acid excretion via the kidney in HK-2 cells&#46; Furthermore&#44; NRBP1 was found to modulate uric acid transporter ABCG2 expression by activating the Wnt&#47;&#946;-catenin signaling pathway&#46; The functional and mechanistic investigations suggested that the interactions between NRBP1 and GSK-3&#946;&#44; which may positively regulate &#946;-catenin&#44; may be the trigger for the activation of the Wnt&#47;&#946;-catenin signaling pathway in the modulates uric acid transporter ABCG2 expression&#46; This study may provide pharmacological evidence to support the anti-hyperuricemic effect of knockdown NRBP1 in the treatment of hyperuricemia and gout&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Authors&#8217; contributions</span><p id="par0125" class="elsevierStylePara elsevierViewall">Zaihua Zhu and Qiankun Zhang conceived and designed the study and performed the experiments and analyzed the data&#46; Hang Fang contributed materials&#44; data and assisted in data analysis&#59; Qiankun Zhang and Hang Fang were the major contributor in writing the manuscript&#46; All authors read and approved the final manuscript&#46;</p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0160">Funding</span><p id="par0130" class="elsevierStylePara elsevierViewall">This study was supported by the funds from Project of the Natural Science Foundation of Zhejiang Province &#40;Grant No&#46;LY20H050009&#41; to Qiankun Zhang and the National Natural ScienceFoundation of China &#40;Grant No&#46; 81701594&#41; to Zaihua Zhu&#46;</p></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0165">Conflict of interest</span><p id="par0135" class="elsevierStylePara elsevierViewall">All authors declare that they have no conflict of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:12 [
        0 => array:3 [
          "identificador" => "xres1866036"
          "titulo" => "Abstract"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Methods"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Results"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1621297"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1866037"
          "titulo" => "Resumen"
          "secciones" => array:4 [
            0 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "M&#233;todos"
            ]
            2 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Resultados"
            ]
            3 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1621298"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Materials and methods"
          "secciones" => array:9 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Cells culture"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Lentivirus infections"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "RNA interference"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Treatment of HK-2 cells"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Quantitative real-time polymerase chain reaction &#40;qRT-PCR&#41;"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Immunofluorescence &#40;IF&#41; staining"
            ]
            6 => array:2 [
              "identificador" => "sec0045"
              "titulo" => "Protein extraction and western blot"
            ]
            7 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "21H7 treatment"
            ]
            8 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Statistical analysis"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0060"
          "titulo" => "Results"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Efficiency of NRBP1 transfection and knockdown"
            ]
            1 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "Effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid"
            ]
            2 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "NRBP1 inhibited ABCG2 expression in the HK-2 cells"
            ]
            3 => array:2 [
              "identificador" => "sec0080"
              "titulo" => "Effect of NRBP1 knockdown or overexpression on the Wnt&#47;&#946;-catenin signaling pathway in HK-2 cells"
            ]
            4 => array:2 [
              "identificador" => "sec0085"
              "titulo" => "Effect of blocking Wnt&#47;&#946;-catenin pathway on NRBP1 mediated ABCG2 expression"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Authors&#8217; contributions"
        ]
        9 => array:2 [
          "identificador" => "sec0100"
          "titulo" => "Funding"
        ]
        10 => array:2 [
          "identificador" => "sec0105"
          "titulo" => "Conflict of interest"
        ]
        11 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2021-03-30"
    "fechaAceptado" => "2021-09-04"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1621297"
          "palabras" => array:5 [
            0 => "Gout"
            1 => "Nuclear receptor binding protein 1"
            2 => "ATP-binding cassette subfamily G member 2"
            3 => "Wnt&#47;&#946;-catenin"
            4 => "Uric acid transporter"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1621298"
          "palabras" => array:5 [
            0 => "Gota"
            1 => "Prote&#237;na de uni&#243;n al receptor nuclear 1"
            2 => "ATP-binding cassette subfamily G member"
            3 => "Wnt&#47;&#946;-catenina"
            4 => "Transportador de &#225;cido &#250;rico"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Nuclear receptor binding protein 1 &#40;NRBP1&#41; and ATP-binding cassette subfamily G member 2 &#40;ABCG2&#41; was the gout risk gene and high-capacity urate exporter respectively&#46; However&#44; the relationship between NRBP1 and ABCG2 and the underlying molecular mechanism contributing to these associations are unknown&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Methods</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">Firstly&#44; the efficiency of the overexpression and knockdown of NRBP1 was confirmed by western blot&#46; Next&#44; the effect of NRBP1 overexpression and knockdown on the expression of ABCG2&#44; organic anion transporter 1 &#40;OAT1&#41;&#44; glucose transporter 9 &#40;GLUT9&#41; and urate transporter 1 &#40;URAT1&#41; was detected by qRT-PCR and western blot&#46; At the same time&#44; the cellular location of ABCG2 and its expression after NRBP1 overexpression and knockdown was tested by immunofluorescence &#40;IF&#41; staining&#46; Then&#44; the mechanism of NRBP1 modulates ABCG2 expression was evaluated by western blot with or without the &#946;-catenin inhibitor &#40;21H7&#41;&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Results</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">The lentivirus system was used to generate stable NRBP1 overexpression&#44; while the plasmids carrying a NRBP1 siRNA was generated to knockdown NRBP1 expression in HK-2 cells&#46; Meanwhile&#44; the overexpression of NRBP1 significantly decreased the mRNAs and proteins expression of GLUT9 and URAT1&#44; while the knockdown of NRBP1 increased the mRNAs and proteins expression of ABCG2 significantly&#46; In addition&#44; the NRBP1 modulates the expression of ABCG2 was by ctivating the Wnt&#47;&#946;-catenin pathway in HK-2 cells according to the IF and western blot results&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Conclusion</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">Taken together&#44; our study demonstrated that NRBP1 inhibition played an essential role in attenuating hyperuricemia and gout by upregulation of ABCG2 via Wnt&#47;&#946;-catenin signaling pathway in HK-2 cells&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Methods"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Results"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0035">Antecedentes</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">La prote&#237;na de uni&#243;n al receptor nuclear 1 &#40;NRBP1&#41; y el miembro G de la subclase ATP binding Box 2 &#40;ABCG2&#41; son los genes de riesgo de gota y los genes de salida de urato de alto rendimiento&#44; respectivamente&#46; Sin embargo&#44; se desconoce la relaci&#243;n entre NRBP1 y ABCG2&#44; y los posibles mecanismos moleculares que conducen a estas asociaciones&#46;</p></span> <span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">M&#233;todos</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">En primer lugar&#44; la sobreexpresi&#243;n y el <span class="elsevierStyleItalic">knockout</span> de NRBP1 fueron confirmados por Western-blot&#46; Los efectos de la sobreexpresi&#243;n y <span class="elsevierStyleItalic">knockout</span> de NRBP1 en la expresi&#243;n de ABCG2&#44; transportador de aniones org&#225;nicos 1 &#40;OAT1&#41;&#44; transportador de glucosa 9 &#40;GLUT9&#41; y transportador de &#225;cido &#250;rico 1 &#40;URAT1&#41; fueron detectados por qRT-PCR y Western-blot&#46; Mientras tanto&#44; la localizaci&#243;n y expresi&#243;n de ABCG2 despu&#233;s de la sobreexpresi&#243;n y <span class="elsevierStyleItalic">knockout</span> de NRBP1 fueron detectadas por inmunofluorescencia &#40;IF&#41;&#46; Luego&#44; el efecto regulador de NRBP1 sobre la expresi&#243;n de ABCG2 fue estudiado por Western-blot y comparado con el inhibidor de la &#946;-catenina &#40;21H7&#41;&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Resultados</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">El sistema lentiviral indujo una sobreexpresi&#243;n estable de NRBP1&#44; mientras que el pl&#225;smido portador de SiRNA NRBP1 inhibi&#243; la expresi&#243;n de NRBP1 en las c&#233;lulas HK-2&#46; Mientras tanto&#44; la sobreexpresi&#243;n de NRBP1 redujo significativamente la expresi&#243;n de ARNm y prote&#237;nas de GLUT9 y URAT1&#44; mientras que el <span class="elsevierStyleItalic">knockout</span> de NRBP1 aument&#243; significativamente la expresi&#243;n de ARNm y prote&#237;nas de ABCG2&#46; Adem&#225;s&#44; de acuerdo con los resultados de IF y Western-blot&#44; NRBP1 regula la expresi&#243;n de ABCG2 activando la v&#237;a Wnt&#47;&#946;-catenina en las c&#233;lulas HK-2&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">Conclusi&#243;n</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">La inhibici&#243;n del NRBP1 aumenta la regulaci&#243;n de ABCG2 a trav&#233;s de la v&#237;a de se&#241;alizaci&#243;n Wnt&#47;&#946;-catenina&#44; que desempe&#241;a un papel importante en la reducci&#243;n de la hiperuricemia y la gota&#46;</p></span>"
        "secciones" => array:4 [
          0 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Antecedentes"
          ]
          1 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "M&#233;todos"
          ]
          2 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Resultados"
          ]
          3 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "multimedia" => array:6 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 2523
            "Ancho" => 2167
            "Tamanyo" => 224405
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">Efficiency of NRBP1 transfection and silencing was confirmed by western blot&#46; &#40;&#967;&#175;&#177;s&#44;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#41;&#44; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Control group&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 3768
            "Ancho" => 3333
            "Tamanyo" => 550565
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Effect of NRBP1 overexpression and knockdown on the secretion and reabsorption of uric acid&#46; A&#44; Effect of NRBP1 overexpression and knockdown on the mRNA expression of NRBP1&#44; ABCG2&#44; OAT1&#44; GLUT9 and URAT1&#46; B&#44; Effect of NRBP1 overexpression and knockdown on the protein expression of NRBP1&#44; ABCG2&#44; OAT1&#44; GLUT9 and URAT1&#46; &#40;&#967;&#175;&#177;s&#44;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#41;&#44; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Control group&#44; <span class="elsevierStyleSup">&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; <span class="elsevierStyleSup">&#35;&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Model group&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 1283
            "Ancho" => 3333
            "Tamanyo" => 472150
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">NRBP1 reduced the expression of ABCG2 protein level in HK-2 cells&#46; A&#44; Representative imaging from immunofluorescent staining &#40;original magnification &#215;200&#41;&#46; B&#44; The relative fluorescent intensity for each group&#46; &#40;&#967;&#175;&#177;s&#44;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#41;&#44; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Control group&#44; <span class="elsevierStyleSup">&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; <span class="elsevierStyleSup">&#35;&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Model group&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 1046
            "Ancho" => 3333
            "Tamanyo" => 187178
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Effect of NRBP1 knockdown or overexpression on the Wnt&#47;&#946;-catenin signaling pathway in HK-2 cells&#46; A&#44; Western blot was used to analyze the expression levels of &#946;-catenin&#44; p-&#946;-catenin&#44; GSK3&#946; and p-GSK3&#946; in stably si-NRBP1-transfected or NRBP-1 overexpression HK-2 cells&#46; B&#8211;C&#44; Semi-quantification of the expression levels of proteins in parts A&#46; &#40;&#967;&#175;&#177;s&#44;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#41;&#44; &#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; &#42;&#42;<span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Control group&#44; <span class="elsevierStyleSup">&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; <span class="elsevierStyleSup">&#35;&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Model group&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig0025"
        "etiqueta" => "Fig&#46; 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 2073
            "Ancho" => 3333
            "Tamanyo" => 328713
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">NRBP1 regulates uric acid transporter ABCG2 expression by activating the Wnt&#47;&#946;-catenin pathway in HK-2 cells&#46; HK-2 cells were transfected with NRBP1 and cultured with 21H7 &#40;Wnt&#47;&#946;-catenin-inhibitor&#41;&#44; western blot was used to analyze the expression levels of NRBP1&#44; &#946;-catenin&#44; p-&#946;-catenin&#44; GSK3&#946; and p-GSK3&#946; in HK-2 cells&#46; &#40;&#967;&#175;&#177;s&#44;<span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>3&#41;&#44; <span class="elsevierStyleSup">&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; <span class="elsevierStyleSup">&#35;&#35;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Model group&#44; <span class="elsevierStyleSup">&#9733;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#44; <span class="elsevierStyleSup">&#9733;&#9733;</span><span class="elsevierStyleItalic">P</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;01 vs&#46; Lenti-NRBP1 group&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:1 [
          "tablatextoimagen" => array:1 [
            0 => array:1 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Gene&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Forward primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Reverse primer&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Human NRBP1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAGGTGAATCAACGGAATGTACC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CTTGTAGTTCTTGCGTTCAGAGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Human ABCG2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CAGGTGGAGGCAAATCTTCGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">ACCCTGTTAATCCGTTCGTTTT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Human OAT1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTTTCGCATCTACTTACGTCCTG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCACATTAACACCAGCACAAAA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Human GLUT9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CCTCTACGGCTACAACCTGTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AGAGTGTCTGGGTCTATTGGAC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Human URAT1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TCTCCACGTTGTGCTGGTTC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GGATGTCCACGACACCAATGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Human &#946;-actin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTTGAGAACCGTGTACCATGT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">TTCCCACAATTTGGCAAGAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Primer sequence of the genes for qRT-PCR analysis &#40;5&#8242;-3&#8242;&#41;&#46;</p>"
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:39 [
            0 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "DNA hypomethylation of a transcription factor binding site within the promoter of a gout risk gene nrbp1 upregulates its expression by inhibition of tfap2a binding"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "Z&#46; Zhu"
                            1 => "W&#46; Meng"
                            2 => "P&#46; Liu"
                            3 => "X&#46; Zhu"
                            4 => "Y&#46; Liu"
                            5 => "H&#46; Zou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Clin Epigenet"
                        "fecha" => "2017"
                        "volumen" => "9"
                        "paginaInicial" => "99"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of the metabolic syndrome in patients with gout&#58; the Third National Health and Nutrition Examination Survey"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "H&#46;K&#46; Choi"
                            1 => "E&#46;S&#46; Ford"
                            2 => "C&#46; Li"
                            3 => "G&#46; Curhan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Care Res &#40;Hoboken&#41;"
                        "fecha" => "2007"
                        "volumen" => "57"
                        "paginaInicial" => "109"
                        "paginaFinal" => "115"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Causal assessment of serum urate levels in cardiometabolic diseases through a mendelian randomization study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "T&#46; Keenan"
                            1 => "W&#46; Zhao"
                            2 => "A&#46; Rasheed"
                            3 => "W&#46;K&#46; Ho"
                            4 => "R&#46; Malik"
                            5 => "J&#46;F&#46; Felix"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.jacc.2015.10.086"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Am Coll Cardiol"
                        "fecha" => "2016"
                        "volumen" => "67"
                        "paginaInicial" => "407"
                        "paginaFinal" => "416"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26821629"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Plasma urate concentration and risk of coronary heart disease&#58; a mendelian randomisation analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; White"
                            1 => "R&#46; Sofat"
                            2 => "G&#46; Hemani"
                            3 => "T&#46; Shah"
                            4 => "J&#46; Engmann"
                            5 => "C&#46; Dale"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S2213-8587(15)00386-1"
                      "Revista" => array:6 [
                        "tituloSerie" => "Lancet Diabetes Endocrinol"
                        "fecha" => "2016"
                        "volumen" => "4"
                        "paginaInicial" => "327"
                        "paginaFinal" => "336"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26781229"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A Mendelian randomization study of circulating uric acid and type 2 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "I&#46; Sluijs"
                            1 => "M&#46;V&#46; Holmes"
                            2 => "Y&#46;T&#46; Van Der Schouw"
                            3 => "J&#46;W&#46;J&#46; Beulens"
                            4 => "F&#46;W&#46; Asselbergs"
                            5 => "J&#46;M&#46; Huerta"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2337/db14-0742"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetes"
                        "fecha" => "2015"
                        "volumen" => "64"
                        "paginaInicial" => "3028"
                        "paginaFinal" => "3036"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25918230"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Uric acid and cardiovascular events&#58; a Mendelian randomization study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;E&#46; Kleber"
                            1 => "G&#46; Delgado"
                            2 => "T&#46;B&#46; Grammer"
                            3 => "G&#46; Silbernagel"
                            4 => "J&#46; Huang"
                            5 => "B&#46;K&#46; Kramer"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Am Soc Nephrol"
                        "fecha" => "2015"
                        "volumen" => "26"
                        "paginaInicial" => "2831"
                        "paginaFinal" => "2838"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hyperuricemia and cardiovascular risk"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "D&#46; Grassi"
                            1 => "G&#46; Desideri"
                            2 => "A&#46;V&#46; Di Giacomantonio"
                            3 => "P&#46; Di Giosia"
                            4 => "C&#46; Ferri"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s40292-014-0046-3"
                      "Revista" => array:6 [
                        "tituloSerie" => "High Blood Press Cardiovasc Prev"
                        "fecha" => "2014"
                        "volumen" => "21"
                        "paginaInicial" => "235"
                        "paginaFinal" => "242"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24554489"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Contemporary epidemiology of gout in the UK general population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "L&#46;C&#46; Soriano"
                            1 => "D&#46; Rothenbacher"
                            2 => "H&#46;K&#46; Choi"
                            3 => "L&#46;A&#46; Garc&#237;a"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/ar3272"
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Res Ther"
                        "fecha" => "2011"
                        "volumen" => "13"
                        "paginaInicial" => "R39"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21371293"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Epidemiology of gout and hyperuricaemia in Italy during the years 2005&#8211;2009&#58; a nationwide population-based study"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "G&#46; Trifir&#8216;o"
                            1 => "P&#46; Morabito"
                            2 => "L&#46; Cavagna"
                            3 => "C&#46; Ferrajolo"
                            4 => "S&#46; Pecchioli"
                            5 => "M&#46; Simonetti"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/annrheumdis-2011-201254"
                      "Revista" => array:6 [
                        "tituloSerie" => "Ann Rheum Dis"
                        "fecha" => "2013"
                        "volumen" => "72"
                        "paginaInicial" => "694"
                        "paginaFinal" => "700"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22736095"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Prevalence of gout and hyperuricemia in the US general population&#58; the National Health andNutrition Examination Survey 2007&#8211;2008"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "Y&#46; Zhu"
                            1 => "B&#46;J&#46; Pandya"
                            2 => "H&#46;K&#46; Choi"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "2011"
                        "volumen" => "63"
                        "paginaInicial" => "3136"
                        "paginaFinal" => "3141"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ABCG2 dysfunction causes hyperuricemia due to both renal urate underexcretion and renal urate overload"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Matsuo"
                            1 => "A&#46; Nakayama"
                            2 => "M&#46; Sakiyama"
                            3 => "T&#46; Chiba"
                            4 => "S&#46; Shimizu"
                            5 => "Y&#46; Kawamura"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Sci Rep"
                        "fecha" => "2014"
                        "volumen" => "20"
                        "paginaInicial" => "3755"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Uric acid and cardiovascular disease&#58; an update from molecular mechanism to clinical perspective"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "W&#46; Yu"
                            1 => "J&#46;D&#46; Cheng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fphar.2020.582680"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Pharmacol"
                        "fecha" => "2020"
                        "volumen" => "11"
                        "paginaInicial" => "582680"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33304270"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Hyperuricemia and risk of stroke&#58; a systematic review and meta-analysis of prospective studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46; Li"
                            1 => "W&#46; Hou"
                            2 => "X&#46; Zhang"
                            3 => "L&#46; Hu"
                            4 => "Z&#46; Tang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.atherosclerosis.2013.11.051"
                      "Revista" => array:6 [
                        "tituloSerie" => "Atherosclerosis"
                        "fecha" => "2014"
                        "volumen" => "232"
                        "paginaInicial" => "265"
                        "paginaFinal" => "270"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24468137"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Renal underexcretion of uric acid is present in patients with apparent high urinary uric acid output"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "F&#46; Perez-Ruiz"
                            1 => "M&#46; Calabozo"
                            2 => "G&#46; Garc&#237;a Erauskin"
                            3 => "A&#46; Ruibal"
                            4 => "A&#46;M&#46; Herrero-Beites"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/art.10792"
                      "Revista" => array:6 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "2002"
                        "volumen" => "47"
                        "paginaInicial" => "610"
                        "paginaFinal" => "613"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12522834"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "SLC2A9 is a high-capacity urate transporter in humans"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46;J&#46; Caulfield"
                            1 => "P&#46;B&#46; Munroe"
                            2 => "D&#46; O&#8217;Neill"
                            3 => "K&#46; Witkowska"
                            4 => "F&#46;J&#46; Charchar"
                            5 => "M&#46; Doblado"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pmed.0050197"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLoS Med"
                        "fecha" => "2008"
                        "volumen" => "5"
                        "paginaInicial" => "e197"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/18842065"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Contribution of intestine and kidney to glucose fluxes in different nutritional states in rat"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G&#46; Mithieux"
                            1 => "A&#46; Gautier-Stein"
                            2 => "F&#46; Rajas"
                            3 => "C&#46; Zitoun"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cbpb.2005.11.007"
                      "Revista" => array:6 [
                        "tituloSerie" => "Comp Biochem Physiol B&#58; Biochem Mol Biol"
                        "fecha" => "2006"
                        "volumen" => "143"
                        "paginaInicial" => "195"
                        "paginaFinal" => "200"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/16412674"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Urate transport via human PAH transporter hOAT1 and its gene structure"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Ichida"
                            1 => "M&#46; Hosoyamada"
                            2 => "H&#46; Kimura"
                            3 => "M&#46; Takeda"
                            4 => "Y&#46; Utsunomiya"
                            5 => "T&#46; Hosoya"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1046/j.1523-1755.2003.00710.x"
                      "Revista" => array:6 [
                        "tituloSerie" => "Kidney Int"
                        "fecha" => "2003"
                        "volumen" => "63"
                        "paginaInicial" => "143"
                        "paginaFinal" => "155"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12472777"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of the urate transporter SLC2A9 gene in susceptibility to gout in New Zealand Maori Pacific Island&#44; and Caucasian case-control sample sets"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;E&#46; Hollis-Moffatt"
                            1 => "X&#46; Xu"
                            2 => "N&#46; Dalbeth"
                            3 => "M&#46;E&#46; Merriman"
                            4 => "R&#46; Topless"
                            5 => "C&#46; Waddell"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Arthritis Rheum"
                        "fecha" => "2009"
                        "volumen" => "60"
                        "paginaInicial" => "3485"
                        "paginaFinal" => "3492"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "NRBP1 is downregulated in breast cancer and NRBP1 over expression inhibits cancer cell proliferation through Wnt&#47;beta-catenin signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Wei"
                            1 => "H&#46; Wang"
                            2 => "Q&#46; Ji"
                            3 => "J&#46; Sun"
                            4 => "L&#46; Tao"
                            5 => "X&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Onco Targets Ther"
                        "fecha" => "2015"
                        "volumen" => "8"
                        "paginaInicial" => "3721"
                        "paginaFinal" => "3730"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nuclear receptor binding protein 1 regulates intestinal progenitor cell homeostasis and tumour formation"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "C&#46;H&#46; Wilson"
                            1 => "C&#46; Crombie"
                            2 => "L&#46; van der Weyden"
                            3 => "G&#46; Poulogiannis"
                            4 => "A&#46;G&#46; Rust"
                            5 => "M&#46; Pardo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/emboj.2012.91"
                      "Revista" => array:6 [
                        "tituloSerie" => "EMBO J"
                        "fecha" => "2012"
                        "volumen" => "31"
                        "paginaInicial" => "2486"
                        "paginaFinal" => "2497"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22510880"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Regulation of stem-like cancer cells by glutamine through &#946;-catenin pathway mediated by redox signaling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46; Liao"
                            1 => "P&#46;P&#46; Liu"
                            2 => "G&#46; Hou"
                            3 => "J&#46; Shao"
                            4 => "J&#46; Yang"
                            5 => "K&#46; Liu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12943-017-0623-x"
                      "Revista" => array:5 [
                        "tituloSerie" => "Mol Cancer"
                        "fecha" => "2017"
                        "volumen" => "16"
                        "paginaInicial" => "51"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28245869"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Celecoxib sensitizes imatinib-resistant K562 cells to imatinib by inhibiting MRP1-5 ABCA2 and ABCG2 transporters via Wnt and Ras signaling pathways"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "G&#46; Dharmapuri"
                            1 => "R&#46; Doneti"
                            2 => "G&#46;H&#46; Philip"
                            3 => "A&#46;M&#46; Kalle"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.leukres.2015.02.013"
                      "Revista" => array:6 [
                        "tituloSerie" => "Leuk Res"
                        "fecha" => "2015"
                        "volumen" => "39"
                        "paginaInicial" => "696"
                        "paginaFinal" => "701"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25916699"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The WNT&#47;&#946;-catenin pathway is involved in the anti-adipogenic activity of cerebrosides from the sea cucumber Cucumaria frondosa"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Xu"
                            1 => "F&#46; Wang"
                            2 => "J&#46; Wang"
                            3 => "J&#46; Xu"
                            4 => "Y&#46; Wang"
                            5 => "C&#46; Xue"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1039/c5fo00273g"
                      "Revista" => array:6 [
                        "tituloSerie" => "Food Funct"
                        "fecha" => "2015"
                        "volumen" => "6"
                        "paginaInicial" => "2396"
                        "paginaFinal" => "2404"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26091058"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dihydrotestosterone regulates hair growth through the Wnt&#47;&#946;-catenin pathway in C57BL&#47;6 mice and in vitro organ culture"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "X&#46; Chen"
                            1 => "B&#46; Liu"
                            2 => "Y&#46; Li"
                            3 => "M&#46; Wan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.3389/fphar.2019.01528"
                      "Revista" => array:5 [
                        "tituloSerie" => "Front Pharmacol"
                        "fecha" => "2019"
                        "volumen" => "10"
                        "paginaInicial" => "1528"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32038233"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Anti-hyperuricemic effects of astaxanthin by regulating xanthine oxidase&#46; Adenosine deaminase and urate transporters in rats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Le"
                            1 => "X&#46; Zhou"
                            2 => "J&#46; Zheng"
                            3 => "F&#46; Yu"
                            4 => "Y&#46; Tang"
                            5 => "Z&#46; Yang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:3 [
                        "tituloSerie" => "Mar Drugs"
                        "fecha" => "2020"
                        "volumen" => "18"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Pharmacological properties and clinical efficacy of dotinurad &#40;URECE&#174; tablets&#41;&#44; a novel hypouricemic agent"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "T&#46; Taniguchi"
                            1 => "N&#46; Ashizawa"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1254/fpj.20047"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nihon Yakurigaku Zasshi"
                        "fecha" => "2020"
                        "volumen" => "155"
                        "paginaInicial" => "426"
                        "paginaFinal" => "434"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33132262"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Dendrobium officinalis six nostrum ameliorates urate under-excretion and protects renal dysfunction in lipid emulsion-induced hyperuricemic rats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "X&#46; Chen"
                            1 => "H&#46;Z&#46; Ge"
                            2 => "S&#46;S&#46; Lei"
                            3 => "Z&#46;T&#46; Jiang"
                            4 => "J&#46; Su"
                            5 => "X&#46; He"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.biopha.2020.110765"
                      "Revista" => array:5 [
                        "tituloSerie" => "Biomed Pharmacother"
                        "fecha" => "2020"
                        "volumen" => "132"
                        "paginaInicial" => "110765"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/33120237"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The association between genetic polymorphisms in ABCG2 and SLC2A9 and urate&#58; an updated systematic review and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "T&#46; Lukkunaprasit"
                            1 => "S&#46; Rattanasiri"
                            2 => "S&#46; Turongkaravee"
                            3 => "A&#46; Thakkinstian"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "BMC Med Genet"
                        "fecha" => "2020"
                        "volumen" => "21"
                        "paginaInicial" => "210"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Gypenosides inhibits xanthine oxidoreductase and ameliorates urate excretion in hyperuricemic rats induced by high cholesterol and high fat food &#40;lipid emulsion&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Pang"
                            1 => "Y&#46; Fang"
                            2 => "S&#46; Chen"
                            3 => "X&#46; Zhu"
                            4 => "C&#46; Shan"
                            5 => "J&#46; Su"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.12659/msm.903217"
                      "Revista" => array:6 [
                        "tituloSerie" => "Med Sci Monit"
                        "fecha" => "2017"
                        "volumen" => "23"
                        "paginaInicial" => "1129"
                        "paginaFinal" => "1140"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28258276"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The molecular physiology of uric acid homeostasis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "A&#46;K&#46; Mandal"
                            1 => "D&#46;B&#46; Mount"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1146/annurev-physiol-021113-170343"
                      "Revista" => array:6 [
                        "tituloSerie" => "Annu Rev Physiol"
                        "fecha" => "2015"
                        "volumen" => "77"
                        "paginaInicial" => "323"
                        "paginaFinal" => "345"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/25422986"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Effects and mechanisms of Dendrobium officinalis Six nostrum for treatment of hyperuricemia with hyperlipidemia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "L&#46;F&#46; Guo"
                            1 => "X&#46; Chen"
                            2 => "S&#46;S&#46; Lei"
                            3 => "B&#46; Li"
                            4 => "N&#46;Y&#46; Zhang"
                            5 => "H&#46;Z&#46; Ge"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1155/2020/2914019"
                      "Revista" => array:5 [
                        "tituloSerie" => "Evid Based Complement Alternat Med"
                        "fecha" => "2020"
                        "volumen" => "2020"
                        "paginaInicial" => "2914019"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/32308702"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Siwu decoction attenuates oxonate-induced hyperuricemia and kidney inflammation in mice"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "R&#46; Wang"
                            1 => "C&#46;H&#46; Ma"
                            2 => "F&#46; Zhou"
                            3 => "L&#46;D&#46; Kong"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/S1875-5364(16)30059-0"
                      "Revista" => array:6 [
                        "tituloSerie" => "Chin J Nat Med"
                        "fecha" => "2016"
                        "volumen" => "14"
                        "paginaInicial" => "499"
                        "paginaFinal" => "507"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/27507200"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Study on anti-trioxypurine effect and mechanism of dendrobium candidum simiao prescription on hyperuricemia rats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Q&#46; Shen"
                            1 => "H&#46; Li"
                            2 => "S&#46;S&#46; Lei"
                            3 => "S&#46;P&#46; Jiang"
                            4 => "B&#46; Li"
                            5 => "X&#46; Zheng"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Chin J Mod Appl Pharm"
                        "fecha" => "2019"
                        "volumen" => "36"
                        "paginaInicial" => "157"
                        "paginaFinal" => "163"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Decreased extra-renal urate excretion is a common cause of hyperuricemia"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Ichida"
                            1 => "H&#46; Matsuo"
                            2 => "T&#46; Takada"
                            3 => "A&#46; Nakayama"
                            4 => "K&#46; Murakami"
                            5 => "T&#46; Shimizu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/ncomms1756"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Commun"
                        "fecha" => "2012"
                        "volumen" => "3"
                        "paginaInicial" => "764"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22473008"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Study on mechanism of compound qiling formula granules in treatment of hyperuricemia in rats"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "Y&#46; Zhang"
                            1 => "H&#46; Xu"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Chin J Mod Appl Pharm"
                        "fecha" => "2020"
                        "volumen" => "37"
                        "paginaInicial" => "1825"
                        "paginaFinal" => "1829"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0375"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Nuclear receptor-binding protein 1&#58; a novel tumour suppressor and pseudokinase"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "J&#46;S&#46; Kerr"
                            1 => "C&#46;H&#46; Wilson"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1042/BST20130069"
                      "Revista" => array:6 [
                        "tituloSerie" => "Biochem Soc Trans"
                        "fecha" => "2013"
                        "volumen" => "41"
                        "paginaInicial" => "1055"
                        "paginaFinal" => "1060"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/23863178"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0380"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "NRBP1 is downregulated in breast cancer and NRBP1 overexpression inhibits cancer cell proliferation through Wnt&#47;&#946;-catenin signaling pathway"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "H&#46; Wei"
                            1 => "H&#46; Wang"
                            2 => "Q&#46; Ji"
                            3 => "J&#46; Sun"
                            4 => "L&#46; Tao"
                            5 => "X&#46; Zhou"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Onco Targets Ther"
                        "fecha" => "2015"
                        "volumen" => "8"
                        "paginaInicial" => "3721"
                        "paginaFinal" => "3730"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            37 => array:3 [
              "identificador" => "bib0385"
              "etiqueta" => "38"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "ABCB1 and ABCG2 drug transporters are differentially expressed in non-small cell lung cancers &#40;NSCLC&#41; and expression is modified by cisplatin treatment via altered Wnt signaling"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Vesel"
                            1 => "J&#46; Rapp"
                            2 => "D&#46; Feller"
                            3 => "E&#46; Kiss"
                            4 => "L&#46; Jaromi"
                            5 => "M&#46; Meggyes"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/s12931-017-0537-6"
                      "Revista" => array:5 [
                        "tituloSerie" => "Respir Res"
                        "fecha" => "2017"
                        "volumen" => "18"
                        "paginaInicial" => "52"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28340578"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            38 => array:3 [
              "identificador" => "bib0390"
              "etiqueta" => "39"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Blockade of ERK1&#47;2 by U0126 alleviates uric acid-induced EMT and tubular cell injury in rats with hyperuricemic nephropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "M&#46; Tao"
                            1 => "Y&#46; Shi"
                            2 => "L&#46; Tang"
                            3 => "Y&#46; Wang"
                            4 => "L&#46; Fang"
                            5 => "W&#46; Jiang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1152/ajprenal.00480.2018"
                      "Revista" => array:6 [
                        "tituloSerie" => "Am J Physiol Renal Physiol"
                        "fecha" => "2019"
                        "volumen" => "316"
                        "paginaInicial" => "F660"
                        "paginaFinal" => "F673"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/30648910"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/02116995/0000004300000002/v1_202303240922/S0211699521002332/v1_202303240922/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "42448"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/02116995/0000004300000002/v1_202303240922/S0211699521002332/v1_202303240922/en/main.pdf?idApp=UINPBA000064&text.app=https://revistanefrologia.com/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699521002332?idApp=UINPBA000064"
]

Información del artículo

ISSN: 02116995
Idioma original: Inglés

DOI:10.1016/j.nefro.2021.09.010

Datos actualizados diariamente

año/Mes	Html	Pdf	Total

2024 Noviembre	7	2	9
2024 Octubre	93	85	178
2024 Septiembre	117	74	191
2024 Agosto	146	90	236
2024 Julio	115	63	178
2024 Junio	146	76	222
2024 Mayo	158	79	237
2024 Abril	141	78	219
2024 Marzo	128	75	203
2024 Febrero	122	78	200
2024 Enero	107	113	220
2023 Diciembre	98	55	153
2023 Noviembre	105	76	181
2023 Octubre	134	86	220
2023 Septiembre	127	93	220
2023 Agosto	98	48	146
2023 Julio	135	67	202
2023 Junio	116	66	182
2023 Mayo	131	83	214
2023 Abril	118	77	195
2023 Marzo	176	58	234
2023 Febrero	131	44	175
2023 Enero	146	54	200
2022 Diciembre	165	64	229
2022 Noviembre	182	71	253
2022 Octubre	174	86	260
2022 Septiembre	153	92	245
2022 Agosto	110	84	194
2022 Julio	122	100	222
2022 Junio	69	66	135
2022 Mayo	80	55	135
2022 Abril	107	66	173
2022 Marzo	117	77	194
2022 Febrero	81	73	154
2022 Enero	125	85	210
2021 Diciembre	12	6	18

Mostrar todo

Indexada en:

Síguenos:

Estadísticas

Indexada en:

Síguenos:

Estadísticas

Suscríbase a la newsletter