Association between PPARγrs1801282 polymorphism with diabetic nephropathy and type-2 diabetes mellitus susceptibility in south India and a meta-analysis

array:24 ["pii" => "S0211699520300345" "issn" => "02116995" "doi" => "10.1016/j.nefro.2020.01.005" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "705" "copyright" => "Sociedad Española de Nefrología" "copyrightAnyo" => "2020" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Nefrologia. 2020;40:287-98" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "itemSiguiente" => array:18 [ "pii" => "S021169951930178X" "issn" => "02116995" "doi" => "10.1016/j.nefro.2019.07.007" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "664" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Nefrologia. 2020;40:299-310" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:2 [ "total" => 324 "formatos" => array:3 [ "EPUB" => 56 "HTML" => 160 "PDF" => 108 ] ] "en" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "The impact of antiviral therapy for HCV on kidney disease: a systematic review and meta-analysis" "tienePdf" => "en" "tieneTextoCompleto" => "en" "tieneResumen" => array:2 [ 0 => "en" 1 => "es" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "299" "paginaFinal" => "310" ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Impacto de la terapia antiviral para VHC en las enfermedades renales: revisión sistemática y meta-análisis" ] ] "contieneResumen" => array:2 [ "en" => true "es" => true ] "contieneTextoCompleto" => array:1 [ "en" => true ] "contienePdf" => array:1 [ "en" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Figure 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 1013 "Ancho" => 2083 "Tamanyo" => 78972 ] ] "descripcion" => array:1 [ "en" => "Funnel plot of precision by Log Ratio (cohorts who received antiviral therapy vs. those who did not; n=8 studies, n=333,312 unique patients)." ] ] ] "autores" => array:1 [ 0 => array:2 [ "autoresLista" => "Fabrizio Fabrizi, Roberta Cerutti, Vivek Dixit, Piergiorgio Messa" "autores" => array:4 [ 0 => array:2 [ "nombre" => "Fabrizio" "apellidos" => "Fabrizi" ] 1 => array:2 [ "nombre" => "Roberta" "apellidos" => "Cerutti" ] 2 => array:2 [ "nombre" => "Vivek" "apellidos" => "Dixit" ] 3 => array:2 [ "nombre" => "Piergiorgio" "apellidos" => "Messa" ] ] ] ] ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S021169951930178X?idApp=UINPBA000064" "url" => "/02116995/0000004000000003/v3_202007050614/S021169951930178X/v3_202007050614/en/main.assets" ] "itemAnterior" => array:20 [ "pii" => "S0211699520300436" "issn" => "02116995" "doi" => "10.1016/j.nefro.2020.04.005" "estado" => "S300" "fechaPublicacion" => "2020-05-01" "aid" => "714" "copyright" => "Sociedad Española de Nefrología" "documento" => "article" "crossmark" => 0 "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/" "subdocumento" => "fla" "cita" => "Nefrologia. 2020;40:279-86" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "es" => array:13 [ "idiomaDefecto" => true "cabecera" => "Original" "titulo" => "Alta prevalencia de COVID-19 asintomático en hemodiálisis. Aprendiendo día a día el primer mes de pandemia de COVID-19" "tienePdf" => "es" "tieneTextoCompleto" => "es" "tieneResumen" => array:2 [ 0 => "es" 1 => "en" ] "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "279" "paginaFinal" => "286" ] ] "titulosAlternativos" => array:1 [ "en" => array:1 [ "titulo" => "High prevalence of asymptomatic COVID-19 in haemodialysis: learning day by day in the first month of the COVID-19 pandemic" ] ] "contieneResumen" => array:2 [ "es" => true "en" => true ] "contieneTextoCompleto" => array:1 [ "es" => true ] "contienePdf" => array:1 [ "es" => true ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0005" "etiqueta" => "Figura 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1253 "Ancho" => 2167 "Tamanyo" => 138720 ] ] "descripcion" => array:1 [ "es" => "Evolución diaria de PCR-SARS-CoV-2 donde se recogen los datos positivos y negativos por clínica y los positivos detectados por cribado." ] ] ] "autores" => array:2 [ 0 => array:2 [ "autoresLista" => "Marta Albalate, Patricia Arribas, Esther Torres, Melissa Cintra, Roberto Alcázar, Marta Puerta, Mayra Ortega, Fabio Procaccini, Juan Martin, Eva Jiménez, Inés Fernandez, Patricia de Sequera" "autores" => array:13 [ 0 => array:2 [ "nombre" => "Marta" "apellidos" => "Albalate" ] 1 => array:2 [ "nombre" => "Patricia" "apellidos" => "Arribas" ] 2 => array:2 [ "nombre" => "Esther" "apellidos" => "Torres" ] 3 => array:2 [ "nombre" => "Melissa" "apellidos" => "Cintra" ] 4 => array:2 [ "nombre" => "Roberto" "apellidos" => "Alcázar" ] 5 => array:2 [ "nombre" => "Marta" "apellidos" => "Puerta" ] 6 => array:2 [ "nombre" => "Mayra" "apellidos" => "Ortega" ] 7 => array:2 [ "nombre" => "Fabio" "apellidos" => "Procaccini" ] 8 => array:2 [ "nombre" => "Juan" "apellidos" => "Martin" ] 9 => array:2 [ "nombre" => "Eva" "apellidos" => "Jiménez" ] 10 => array:2 [ "nombre" => "Inés" "apellidos" => "Fernandez" ] 11 => array:2 [ "nombre" => "Patricia" "apellidos" => "de Sequera" ] 12 => array:1 [ "colaborador" => "Grupo de Enfermería HUIL" ] ] ] 1 => array:2 [ "autoresLista" => "" "autores" => array:1 [ 0 => array:1 [ "colaborador" => "Grupo enfermería HUIL" ] ] ] ] ] "idiomaDefecto" => "es" "Traduccion" => array:1 [ "en" => array:9 [ "pii" => "S2013251420300754" "doi" => "10.1016/j.nefroe.2020.06.013" "estado" => "S300" "subdocumento" => "" "abierto" => array:3 [ "ES" => true "ES2" => true "LATM" => true ] "gratuito" => true "lecturas" => array:1 [ "total" => 0 ] "idiomaDefecto" => "en" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2013251420300754?idApp=UINPBA000064" ] ] "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699520300436?idApp=UINPBA000064" "url" => "/02116995/0000004000000003/v3_202007050614/S0211699520300436/v3_202007050614/es/main.assets" ] "en" => array:22 [ "idiomaDefecto" => true "cabecera" => "Original article" "titulo" => "Association between PPARγrs1801282 polymorphism with diabetic nephropathy and type-2 diabetes mellitus susceptibility in south India and a meta-analysis" "tieneTextoCompleto" => true "paginas" => array:1 [ 0 => array:2 [ "paginaInicial" => "287" "paginaFinal" => "298" ] ] "autores" => array:1 [ 0 => array:4 [ "autoresLista" => "Ilibagiza Regine, Rehman Syed Rasheed Akram Husain, Rajagopalan P. Aswathi, D. Ramacharan Reddy, Shiek S.S.J. Ahmed, Veerabathiran Ramakrishnan" "autores" => array:6 [ 0 => array:3 [ "nombre" => "Ilibagiza" "apellidos" => "Regine" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "1" "identificador" => "fn0005" ] ] ] 1 => array:3 [ "nombre" => "Rehman Syed Rasheed Akram" "apellidos" => "Husain" "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "1" "identificador" => "fn0005" ] ] ] 2 => array:3 [ "nombre" => "Rajagopalan P." "apellidos" => "Aswathi" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] ] ] 3 => array:3 [ "nombre" => "D. Ramacharan" "apellidos" => "Reddy" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "b" "identificador" => "aff0010" ] ] ] 4 => array:3 [ "nombre" => "Shiek S.S.J." "apellidos" => "Ahmed" "referencia" => array:1 [ 0 => array:2 [ "etiqueta" => "c" "identificador" => "aff0015" ] ] ] 5 => array:4 [ "nombre" => "Veerabathiran" "apellidos" => "Ramakrishnan" "email" => array:1 [ 0 => "rkgenes@gmail.com" ] "referencia" => array:2 [ 0 => array:2 [ "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:2 [ "etiqueta" => "*" "identificador" => "cor0005" ] ] ] ] "afiliaciones" => array:3 [ 0 => array:3 [ "entidad" => "Genetics Lab, Faculty of Allied Health Sciences, Chettinad Academy of Research and Education, Kelambakkam, Tamil Nadu, India" "etiqueta" => "a" "identificador" => "aff0005" ] 1 => array:3 [ "entidad" => "Department of General Medicine, Chettinad Hospital and Research Institute, Chettinad Health City, Kelambakkam, Tamil Nadu, India" "etiqueta" => "b" "identificador" => "aff0010" ] 2 => array:3 [ "entidad" => "Drug Discovery Lab, Faculty of Allied Health Sciences, Chettinad Academy of Research and Education, Kelambakkam, Tamil Nadu, India" "etiqueta" => "c" "identificador" => "aff0015" ] ] "correspondencia" => array:1 [ 0 => array:3 [ "identificador" => "cor0005" "etiqueta" => "⁎" "correspondencia" => "Corresponding author." ] ] ] ] "titulosAlternativos" => array:1 [ "es" => array:1 [ "titulo" => "Asociación entre el polimorfismo rs1801282 de PPARγ con nefropatía diabética y sensibilidad a la diabetes mellitus de tipo 2 en el sur de India y un metaanálisis" ] ] "resumenGrafico" => array:2 [ "original" => 0 "multimedia" => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 3085 "Ancho" => 3167 "Tamanyo" => 733734 ] ] "descripcion" => array:1 [ "en" => "Circos plot illustrating the chromosomal interactions among the current SNP (rs1801282) and its associated SNPs. The Circos plot (outer to inner) denotes chromatin states, annotated genes, histone modifications, transcription factors, rs1801282 variant with associated SNPs (r2)." ] ] ] "textoCompleto" => "IntroductionDiabetes Mellitus (T2DM) is a complex metabolic disorder characterized by abnormal lipid, protein metabolism, and hyperglycemia. T2DM is considered as serious health problem globally and ranks as the world's sixth-leading factor causing death.<a class="elsevierStyleCrossRef" href="#bib0190">1</a> Diabetic Nephropathy is one of the major complication of T2DM and the primary cause of the end-stage renal disease (ESRD), with a high morbidity rate from 25 to 40% globally.<a class="elsevierStyleCrossRef" href="#bib0195">2</a> Abnormal glycaemic control and diabetes duration are considered as the major risk factors for DN. The pathogenesis and advancement of T2DM to DN is not well established, previous epidemiological and clinical studies have demonstrated the role of hyperlipidemia in the glomerular injury through the initiation and activation of multiple signaling pathways.<a class="elsevierStyleCrossRef" href="#bib0200">3</a> A meta-analysis was performed in the year 2011 to evaluate the genetic associations with DN from various ethnic populations which revealed 21 significantly associated genes such as APOC1, ACE, AKR1B1, APOE, CHN2, EPO, ‘GREM1, NOS3, HSPG2, FRMD3, CPVL, VEGFA, CARS, and UNC13B.<a class="elsevierStyleCrossRef" href="#bib0205">4</a> In addition, several Genome-Wide Association studies have documented 56 genetic loci associated with T2DM susceptibility. Also, few single nucleotide polymorphisms (SNPs) were reported in candidate genes such as FTO, MC4R, PPARγ, and ADIPOQ with T2DM.<a class="elsevierStyleCrossRefs" href="#bib0210">5,6</a>Peroxisome Proliferator-Activated Receptor-Gamma (PPARγ) gene belongs to the nuclear hormone receptor subfamily which controls the expression of genes involved in insulin sensitivity, lipogenesis, adipocyte differentiation, inflammation, and metabolic syndrome.<a class="elsevierStyleCrossRef" href="#bib0220">7</a> PPARγ gene is localized at 3p25.2 spanning 9 exons encodes 505 amino acids. The PPARs mainly comprise nuclear fatty acid receptors, which have a hydrophobic ligand-binding pocket and a zinc finger DNA binding motif (type-II).<a class="elsevierStyleCrossRef" href="#bib0225">8</a> To date, numerous case–control studies have been conducted to identify the possible relationship between PPARγ gene polymorphisms with the risk of T2DM and DN in various ethnic populations.<a class="elsevierStyleCrossRef" href="#bib0230">9</a> The most common variant located in exon-2 of PPARγ rs1801282 (Proline-12-Alanine), leading to the substitution of cytosine to guanosine at 34th nucleotide position. This substitution leads to a change in the structure of PPARG protein, which in turn decreases the binding effect of target genes and thereby reducing transcriptional activity.<a class="elsevierStyleCrossRef" href="#bib0235">10</a> In addition, studies have indicated that rs1801282 polymorphism is found involved in reducing the albuminuria risk and insulin resistance among DM patients.<a class="elsevierStyleCrossRef" href="#bib0240">11</a> Among worldwide population, Indians belong to the Asian ethnic background, considered as a high-risk population for T2DM. It has been well documented that Asian Indians have a high waist-hip ratio, greater insulin resistance, increased susceptibility to diabetes and posses the risk of coronary heart disease (CHD) compared with Europeans or the Caucasoids.<a class="elsevierStyleCrossRef" href="#bib0245">12</a> We conducted a case–control study among the south Indian population belong to Asian ethnic background to determine the rs1801282 association in DN, T2DM, compared to healthy controls, Further, the resulting genotypic frequencies of rs1801282 polymorphism were analyzed with the previously published literature based on the Preferred Reporting Items for Systematic Reviews and Meta-analysis (PRISMA) criteria to confirm its significance across various populations.MethodsSample characteristicsThe samples (diabetic nephropathy, type-2 diabetes mellitus, and healthy controls) for this study were recruited from the subjects attending Department of General Medicine, Chettinad Hospital and Research Institute (CHRI), Tamil Nadu, India, from January to June 2016. The selection criteria for DN subjects by clinical examination including the routine biochemical assessment such as excreting urine albuminuria (>300mg/L) and serum creatinine (>1mg/dL) were considered and histopathological investigation. The T2DM subjects were diagnosed based on the criteria defined by the World Health Organization (WHO).<a class="elsevierStyleCrossRef" href="#bib0250">13</a> The controls were selected by following the similar clinical and biochemical examination as done for DN and T2DM. All study participant were age-matched, belonging to South India, Asian ethnicity. The current study protocols were reviewed and approved by the Institutional Human Ethics Committee (03/IHEC/3-16) of the Chettinad Academy of Research and Education. Informed consent was obtained from the participants before the sampling process. Likewise, HIV positive patients, Juvenile diabetic subjects, physically challenged and subjects with cardiac problems were excluded. The demographic data and baseline clinical characteristics from each study subject including gender, age, Body Mass Index (BMI), the onset of disease, symptoms of the disease, family history, diet, and physical activity were recorded at the time sample collection.Genetic analysis of rs1801282 polymorphismVenous blood (3ml) was collected in EDTA coated tube (BD, USA) from the participants to isolate Genomic DNA using the phenol-chloroform method with minor modifications.<a class="elsevierStyleCrossRef" href="#bib0255">14</a> The genetic analysis of rs1801282 was performed by Amplification Refractory Mutation System-Polymerase Chain Reaction (ARMS-PCR) using allele-specific primers (<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>).<a class="elsevierStyleCrossRef" href="#bib0260">15</a> For each PCR reaction, a 10μL reaction mix was setup containing 25ng DNA, 1U TAQ Brazilian Origin, 0.3mmol of each dNTP, 12pmol/μL of each primer. The ARMS-PCR program was performed using an ABI Veriti® Thermal Cycler (California, USA). The reaction condition for ARMS-PCR was set as initial denaturation (94°C, 5min), denaturation (94°C, 45s), annealing (68°C, 45s), elongation (72°C, 45s) and final elongation at 72°C for 5min. The amplicons were visualized on 1.6% agarose gel together with 100bp DNA Ladder (Dye Plus, Cat no: 3422A, Takara Bio). Finally, the identified genotypes were further confirmed in the randomly selected subset of overall samples (DN=12; T2DM =10; controls=08) using Sanger based sequencing (Applied Biosystems 3130, USA). Additionally, to determine the chromosomal interactions among the SNP variants, we used 3DSNP (<a href="http://www.cbportal.org/3dsnp/index.html">http://www.cbportal.org/3dsnp/index.html</a>) software package to generate Circos (circular) plots based on r2 values for visualizing the genomic data.<elsevierMultimedia ident="tbl0005"></elsevierMultimedia>Statistical analysesThe statistical analysis for case–control study was executed by SPSS V.21 (IBM-Analytics, USA) software. The allelic and genotypic frequencies of rs1801282 polymorphism in DN, T2DM and healthy controls were calculated using the Pearson Chi-square test. To determine the distribution of SNP in controls, Hardy-Weinberg Equilibrium (HWE value>0.05) was used. Additionally, their association of polymorphism was analyzed by determining the odds ratio (OR), confidence intervals (95% CIs) in dominant (Jj+jj vs. Jj) (J-major, j-minor allele) and recessive (jj vs. JJ+Jj) genetic models.Literature search strategy for Meta-analysisAn extensive literature to select the studies published between January 1991 to December 2017, that discuss the association between rs1801282 polymorphism with DN and T2DM from the database of MEDLINE, PubMed, Cochrane Library, EMBASE, and Google Scholar. The multiple key terms such as “Diabetic Nephropathy” “Type 2 Diabetes Mellitus”, “DN”, “T2DM”, “Peroxisome proliferator-activated receptor gamma gene”, “PPARγ gene”, “Polymorphism”, “rs1801282” were used to retrieve the relevant articles published in English Language for the meta-analysis with Diabetic Nephropathy vs. Type 2 Diabetes Mellitus. Similarly, multiple keywords such as “Type 2 Diabetes Mellitus”, “T2DM”, “Peroxisome proliferator-activated receptor gamma gene”, “PPARγ gene”, “Genetic association studies”, “SNP”, “rs1801282” were used to perform the similar meta-analysis between T2DM vs. controls.Data extraction for meta-analysisStudies included in this meta-analysis (Diabetic Nephropathy vs. Type 2 Diabetes Mellitus; Type 2 Diabetes Mellitus vs. controls) were essential to meet the following criteria's: first, the association of PPARγ gene and rs1801282 polymorphism with DN and T2DM, T2DM and controls should be assessed. Second, study should be cases–controls (two groups). Third, the articles should provide adequate data to calculate allele and genotype frequencies for the meta-analysis. The information from the collected articles was extracted by two authors [AH and PA], any discrepancy between the authors was resolved by a group discussion (IR, SSJ, and RK). The study characteristics such as first author name, year of publication, country, ethnicity, the source of DNA, the sample size for cases-controls, genotypic frequency and genotyping method were extracted.Quality assessment and meta-analysis for rs1801282 polymorphismThe methodological quality assessment of each study was evaluated by two independent variables such as the Hardy-Weinberg Equilibrium (HWE)<a class="elsevierStyleCrossRef" href="#bib0265">16</a> and the Newcastle Ottawa Scale (NOS).<a class="elsevierStyleCrossRef" href="#bib0270">17</a> The genotype distribution of included studies among the controls should follow HWE p-value above 0.05. The NOS grading system relies on three main factors such as selection, comparability, and exposure. The studies score up to a maximum of nine points, six or above were considered in this meta-analysis. In the meta-analysis, rs1801282 SNP with risk of DN vs. T2DM and T2DM vs. controls, were performed to calculate the pooled odds ratios (OR) and 95% confidence interval (CI) with (p-value<0.05) under allelic (j vs. J) (J-major, j-minor allele), homozygote (jj vs. JJ), heterozygote (Jj vs. JJ), dominant (Jj+jj vs. JJ) and recessive (jj vs. JJ+Jj) genetic models. The heterogeneity between the included studies in this meta-analysis was assessed by the I2 test<a class="elsevierStyleCrossRef" href="#bib0275">18</a> and Q-statistics. Based on the results obtained from heterogeneity (I2<50), fixed effect (Mantel-Haenszel's)<a class="elsevierStyleCrossRef" href="#bib0280">19</a> method was used, if not, the random-effect method (DerSimonian and Laird's) was applied. The publication bias for meta-analysis was assessed by Begg's funnel plot and Egger's test.<a class="elsevierStyleCrossRef" href="#bib0285">20</a> Leave-one-out method was executed to validate the consistency of our results.<a class="elsevierStyleCrossRef" href="#bib0290">21</a> The meta-analysis was performed using Revman V.5.0 (Cochrane Collaboration, UK) and STATA V.12.0 (Stata Corp, USA).ResultsCharacteristics of study subjects in case–control studyThe baseline clinical characteristics of the study participants (DN=128; T2DM=148 and controls=148) were illustrated in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>. Among the samples enrolled in the study, their average±SD of age in DN, T2DM, and control groups were 56.26±8.9, 54.75±6.37 and 54.15±7.50 years respectively. Similarly, the body mass index (BMI) were (21.09±3.3), (26.23±3.68) and (23.08±2.37) for DN, T2DM and control.<elsevierMultimedia ident="tbl0010"></elsevierMultimedia>Frequencies rs1801282 polymorphism between DN vs. T2DMThe genotyping of PPARγ gene polymorphism (rs1801282) was performed using ARMS-PCR and Sanger dideoxy sequencing (<a class="elsevierStyleCrossRef" href="#fig0005">Fig. 1</a>). The genotype frequency distributions in controls (T2DM) were in concurrence with Hardy–Weinberg Equilibrium (p>0.05). The allele and genotype frequencies of rs1801282 polymorphisms were assessed to determine the odds ratio (OR), confidence intervals (95%CIs), χ2 and p-value (<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>). The genotype distribution of rs1801282 polymorphism was 73.43% for JJ, 17.18% for Jj, 09.37% for jj in DN cases and 67.56%, 27.02%, 5.40% in T2DM, respectively. The analysis of rs1801282 polymorphism illustrated a positive association with DN compared with T2DM (p-value≤0.05) in south India. In heterozygous (Jj) and homozygous recessive genotype (jj) model of rs1801282 showed significant risk association in DN patients compared with T2DM with OR=1.19 (95%CI [0.75–1.98]) p-value=0.049, OR=2.72 (95%CI [0.96–7.67]) p-value=0.047, respectively. Further, the analysis of dominant and recessive genetic models showed an insignificant difference between DN and T2DM for rs1801282 polymorphism.<elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia>Frequencies of rs1801282 polymorphism with T2DM vs. controlsThe susceptibility analysis of rs1801282 polymorphism with T2DM and controls was performed. The genotypic frequency distribution in healthy controls was in agreement with HWE (p>0.05). The allele and genotype frequencies of rs1801282 polymorphisms were used to estimate the odds ratio (OR), confidence intervals (95% CIs), χ2 and p-value (<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>). The genotypic distribution of rs1801282 polymorphism was 67.56% for JJ, 27.02% for Jj, 05.40% for jj in T2DM and 81.08%, 16.21%, 02.70% in controls, respectively. The analysis of rs1801282 polymorphism showed a positive association with T2DM compared with controls (p-value≤0.05). The minor ‘G’ allele showed a positive association among T2DM and controls with OR=1.92 (95%CI [1.20–3.07]) p-value=0.003. In heterozygous (Jj) genotype of rs1801282 showed significant risk association among T2DM and controls with OR=2.00 (95%CI [1.12–3.54]) p-value=0.011, respectively. Likewise, the analysis of dominant genetic model showed significant association among T2DM and controls with OR=1.48 (95%CI [0.28–3.83]) p-value=0.005 for rs1801282 polymorphism.<elsevierMultimedia ident="tbl0020"></elsevierMultimedia>Frequencies of rs1801282 polymorphism between DN and controlsThe susceptibility analysis of rs1801282 variant with DN and controls was performed (<a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>). The genotype frequency distributions in controls were in agreement with HWE (p>0.05). The genotype distribution of rs1801282 polymorphism was 73.43% for JJ, 17.18% for Jj, 09.37% for jj in DN cases and 81.08%, 16.21%, 02.70% in control, respectively. The minor ‘G’ allele showed a positive association among T2DM and control with OR=1.80 (95%CI [1.13–2.93]) p-value=0.011. However, the analysis of rs1801282 polymorphism showed a negative association between DN and control with p-value≥0.05 in the heterozygote, homozygous recessive, dominant and recessive genetic models, respectively. The nucleotide sequences of PPARγ genotypes were deposited (Accession numbers: KY547832, KY547833, KY547834, KY547835, and KY547836) in the NCBI Genbank [<a href="https://www.ncbi.nlm.nih.gov/genbank/">https://www.ncbi.nlm.nih.gov/genbank/</a>] database. The Circos plot (outer circle to inner) illustrates the chromatin states, annotated genes, histone modifications, transcription factors, currently studied variant (rs1801282) with related SNPs (r2) and 3D chromatin interactions (<a class="elsevierStyleCrossRef" href="#fig0010">Fig. 2</a>).<elsevierMultimedia ident="tbl0025"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia>Studies characteristics of rs1801282 polymorphism with DN vs. TD2M for meta-analysisIn meta-analysis, a total of 678 papers published before December 2017 was retrieved from the initial search in literature databases. The editorials, review articles, duplicates, and case reports were removed after a screening of the abstracts. Further, the studies were assessed for quality control methods such as Hardy-Weinberg Equilibrium and Newcastle Ottawa Scale. Thus, four studies<a class="elsevierStyleCrossRefs" href="#bib0295">22–25</a> were added to the meta-analysis of rs1801282 polymorphism and the characteristics of included studies in this meta-analysis were explained in supplementary Table 1. The genotypic, allelic frequencies and HWE/Chi-square values for the included studies were presented in <a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a>.<elsevierMultimedia ident="tbl0030"></elsevierMultimedia>Studies characteristics of rs1801282 polymorphism with T2DM vs. control for meta-analysisThe literature search published from 1991 up to December 2017 retrieved 846 relevant studies from several electronic databases. After removing the duplicate studies, case reports, studies on cell lines, 236 records remained. According to the quality assessment criteria, followed by HWE analysis, nine studies T2DM=6365, controls =5322 participants<a class="elsevierStyleCrossRefs" href="#bib0315">26–33</a> were eligible for this meta-analysis. The characteristics (author name, year of publication, country, ethnicity, DNA source, a sample size of cases-controls and genotyping methods) of each study included in the meta-analysis were defined in supplementary Table 2. The genotype, allele frequencies, and HWE/Chi-square values for the studies included in this meta-analysis were presented in <a class="elsevierStyleCrossRef" href="#tbl0035">Table 7</a>.<elsevierMultimedia ident="tbl0035"></elsevierMultimedia>Meta-analysis of rs1801282 polymorphism with DN vs. TD2M susceptibilityThe analysis of rs1801282 polymorphism among DN and T2DM revealed no heterogeneity in allelic (I2=22%) and dominant (I2=18%). Whereas, moderate heterogeneity was noticed in homozygote (I2=49%), heterozygote (I2=52%) and recessive (I2=44%) genetic models. Based on values of heterogeneity (I2) the fixed effects (Mantel–Haenszel's) model was implemented, which showed insignificant association with DN risk in allelic (j vs J) with (Q test p=0.27), OR=0.89, (95%CI [0.71–1.10]), p=0.26, homozygote (jj vs JJ) (Q test p=0.12), OR=0.87, (95% CI [0.66–1.12]), p=0.27, dominant (Jj+jj vs JJ) (Q test p=0.30), OR=0.86, (95% CI [0.66–1.12]), p=0.27 and recessive (jj vs JJ+Jj) (Q test p=0.15), OR=0.88, (95% CI [0.54–1.44]), p=0.61 genetic models, respectively. Whereas, the random effects model was used which showed insignificant association with DN risk in the heterozygote (Jj vs JJ) (Q test p=0.10), OR=1.03, (95% CI [0.44–2.41]), p=0.94. The results of the meta-analysis were shown as forest plots (<a class="elsevierStyleCrossRef" href="#fig0015">Fig. 3</a>). Further, funnel plot (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>) and Egger's test was executed which revealed no publication bias in the studied genetic models. Since a low number of studies were from Caucasian and Asian ethnicity, sub-group meta-analysis was not performed.<elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="fig0025"></elsevierMultimedia>Meta-analysis of rs1801282 polymorphism with T2DM vs. controlsThe analysis of rs1801282 polymorphism various T2DM vs. controls revealed moderate heterogeneity in the heterozygote (I2=31%) and high heterogeneity was noticed in allelic (I2=90%), homozygote (I2=51%), dominant (I2=88%) and recessive (I2=45%) genetic models. Based on values of heterogeneity (I2), the random-effect method (DerSimonian and Laird's) was adopted which showed insignificant association with T2DM risk in allelic (j vs J) with (Q test p=0.00001), OR=0.91, (95%CI [0.64–1.30]), p=0.61, homozygote (jj vs JJ) (Q test p=0.05), OR=1.22, (95% CI [0.62–2.41]), p=0.57, dominant (Jj +jj vs JJ) (Q test p=0.00001), OR=0.91, (95% CI [0.64–1.31]), p=0.62 and recessive (jj vs JJ+ Jj) (Q test p=0.08), OR=1.23, (95% CI [0.65–2.30]), p=0.52 genetic models respectively. The fixed effects (Mantel-Haenszel's) model was used, which showed significant association with DN risk in heterozygote (Jj vs JJ) (Q test p=0.18), OR=0.56, (95% CI [0.43–0.74]), p≤0.0001. The results of meta-analysis were illustrated as forest plot (<a class="elsevierStyleCrossRef" href="#fig0020">Fig. 4</a>). Further, Begg's funnel plot (<a class="elsevierStyleCrossRef" href="#fig0025">Fig. 5</a>) and Egger's regression test were performed which suggested no publication bias in the analyzed genetic models. Since a low number of studies were from Caucasian ethnicity, sub-group analysis was not performed.<elsevierMultimedia ident="fig0020"></elsevierMultimedia>DiscussionT2DM is a complex metabolic disorder where environmental, genetic factors and lifestyle contributing to disease pathogenesis.<a class="elsevierStyleCrossRef" href="#bib0355">34</a> The DN susceptibility has been related to various genes localized at different chromosomes. Of various genes, the PPARγ nuclear receptor expressed in adipose tissue and renal glomeruli play a major role in the developmental process of DN.<a class="elsevierStyleCrossRef" href="#bib0360">35</a> The rs1801282 polymorphism has been found to be linked with the reduced ability of trans-activate responsive promoters and thereby lowering the PPAR-γ transcriptional activity.<a class="elsevierStyleCrossRef" href="#bib0365">36</a> On the other hand, PPARs is a potential target for the Glitazones or Thiazolidinediones (TZDs) for the management of T2DM.<a class="elsevierStyleCrossRef" href="#bib0370">37</a>In this study, we have validated the association between PPARγ (rs1801282) polymorphism with the risk of developing DN, T2DM in the south Indian population by comparing 1) DN vs. T2DM, 2) DN vs. controls and 3) T2DM vs. controls. The analysis revealed a positive association with p-value<0.05 between DN and T2DM subjects suggesting that rs1801282 polymorphism might be a risk factor for DN in our study population. These results deviate from a previously published study from the DN subjects of Turkey.<a class="elsevierStyleCrossRef" href="#bib0300">23</a> The analysis of rs1801282 polymorphism among T2DM and controls showed significant association (p-value≤0.05) in derived’G’ allele and heterozygous genotype. These results were in accordance with a previously published study on Japanese subjects belonging to East Asian ethnicity.<a class="elsevierStyleCrossRef" href="#bib0330">29</a>In addition, we have performed a meta-analysis for rs1801282 polymorphism to investigate the effect of the PPARγ gene on susceptibility with DN and T2DM in mixed population. For, which the articles related on DN and T2DM were retrieved from several electronic databases based on PRISMA guidelines and NOS scaling was used for quality assessment. The results of our meta-analysis showed insignificant association with DN in the allelic OR=0.89, (95%CI [0.71–1.10]), homozygote OR=0.87, (95% CI [0.66–1.12]), heterozygote OR=1.03, (95% CI [0.44–2.41]), dominant OR=0.86, (95% CI [0.66–1.12]), and recessive OR=0.88, (95% CI [0.54–1.44]) genetic models respectively. Similar to the results of this meta-analysis, rs1801282 polymorphism shows an insignificant association in Turkey 23 and Taiwan 25 populations.The meta-analysis of Type 2 Diabetes Mellitus and controls showed significant association among T2DM and controls in the heterozygote genetic model with OR=0.56, (95% CI [0.43–0.74]) and insignificant association allelic OR=0.91, (95%CI [0.64–1.30]), homozygote OR=1.22, (95%CI [0.62–2.41]), dominant OR=0.91, (95%CI [0.64–1.31]), and recessive OR=1.23, (95%CI [0.65–2.30]) genetic models respectively. The results of meta- were in agreement with Japan 29 and Central India 32 whereas disagreement was noticed with Han Chinese 28 population. Overall, the analysis provides significant knowledge on rs1801282 with DN and T2DM in both south Indian and mixed population. However, the results of our analysis can be considered with certain limitations. First, we studied the association between PPARγ genotypes (rs1801282) among DN, T2DM and their phenotypes were not studied extensively. Second, T2DM is a multi-factorial metabolic disorder, other confounding factors including age, gender, obesity, lifestyle habits, and other environmental factors were not considered in our analysis. Third, the studies included in our meta-analysis were restricted to articles published in the English language. Fourth, the genotyping methods were not the same in the included studies. Fifth, we have studied only one SNP (rs1801282) in the PPARγ gene other polymorphic variants were not considered.ConclusionIn conclusion, our case–control study demonstrates the involvement of PPARγ gene (rs1801282) variant among DN and T2DM in South Indian population. Alternative results were noticed in other population may be due to genetic diversity. However, independent replication studies with larger sample size are required to confirm the associations that we observed in this study. Alternatively, the meta-analysis of DN vs. controls suggests that the PPARγ polymorphism is not a risk factor for developing DN. Whereas, a meta-analysis of T2DM vs. controls suggests that rs1801282 polymorphism result showed a positive association for developing T2DM. Further, well designed, large-scale studies combining with other multiple factors are required to validate the PPARγ gene associated with risk of developing DN and T2DM.FundingThe author (RI) thanks the Chettinad Academy of Research and Education for funding this research.Conflicts of interestThe authors declare that they have no conflict of interest." "textoCompletoSecciones" => array:1 [ "secciones" => array:13 [ 0 => array:3 [ "identificador" => "xres1358449" "titulo" => "Abstract" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Objective" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Methods" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Results" ] 4 => array:2 [ "identificador" => "abst0025" "titulo" => "Conclusion" ] ] ] 1 => array:2 [ "identificador" => "xpalclavsec1249390" "titulo" => "Keywords" ] 2 => array:3 [ "identificador" => "xres1358448" "titulo" => "Resumen" "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0030" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0035" "titulo" => "Objetivo" ] 2 => array:2 [ "identificador" => "abst0040" "titulo" => "Métodos" ] 3 => array:2 [ "identificador" => "abst0045" "titulo" => "Resultados" ] 4 => array:2 [ "identificador" => "abst0050" "titulo" => "Conclusión" ] ] ] 3 => array:2 [ "identificador" => "xpalclavsec1249389" "titulo" => "Palabras clave" ] 4 => array:2 [ "identificador" => "sec0005" "titulo" => "Introduction" ] 5 => array:3 [ "identificador" => "sec0010" "titulo" => "Methods" "secciones" => array:6 [ 0 => array:2 [ "identificador" => "sec0015" "titulo" => "Sample characteristics" ] 1 => array:2 [ "identificador" => "sec0020" "titulo" => "Genetic analysis of rs1801282 polymorphism" ] 2 => array:2 [ "identificador" => "sec0025" "titulo" => "Statistical analyses" ] 3 => array:2 [ "identificador" => "sec0030" "titulo" => "Literature search strategy for Meta-analysis" ] 4 => array:2 [ "identificador" => "sec0035" "titulo" => "Data extraction for meta-analysis" ] 5 => array:2 [ "identificador" => "sec0040" "titulo" => "Quality assessment and meta-analysis for rs1801282 polymorphism" ] ] ] 6 => array:3 [ "identificador" => "sec0045" "titulo" => "Results" "secciones" => array:8 [ 0 => array:2 [ "identificador" => "sec0050" "titulo" => "Characteristics of study subjects in case–control study" ] 1 => array:2 [ "identificador" => "sec0055" "titulo" => "Frequencies rs1801282 polymorphism between DN vs. T2DM" ] 2 => array:2 [ "identificador" => "sec0060" "titulo" => "Frequencies of rs1801282 polymorphism with T2DM vs. controls" ] 3 => array:2 [ "identificador" => "sec0065" "titulo" => "Frequencies of rs1801282 polymorphism between DN and controls" ] 4 => array:2 [ "identificador" => "sec0070" "titulo" => "Studies characteristics of rs1801282 polymorphism with DN vs. TD2 M for meta-analysis" ] 5 => array:2 [ "identificador" => "sec0075" "titulo" => "Studies characteristics of rs1801282 polymorphism with T2DM vs. control for meta-analysis" ] 6 => array:2 [ "identificador" => "sec0080" "titulo" => "Meta-analysis of rs1801282 polymorphism with DN vs. TD2 M susceptibility" ] 7 => array:2 [ "identificador" => "sec0085" "titulo" => "Meta-analysis of rs1801282 polymorphism with T2DM vs. controls" ] ] ] 7 => array:2 [ "identificador" => "sec0090" "titulo" => "Discussion" ] 8 => array:2 [ "identificador" => "sec0095" "titulo" => "Conclusion" ] 9 => array:2 [ "identificador" => "sec0100" "titulo" => "Funding" ] 10 => array:2 [ "identificador" => "sec0105" "titulo" => "Conflicts of interest" ] 11 => array:2 [ "identificador" => "xack471369" "titulo" => "Acknowledgment" ] 12 => array:1 [ "titulo" => "References" ] ] ] "pdfFichero" => "main.pdf" "tienePdf" => true "fechaRecibido" => "2019-07-29" "fechaAceptado" => "2020-01-19" "PalabrasClave" => array:2 [ "en" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Keywords" "identificador" => "xpalclavsec1249390" "palabras" => array:5 [ 0 => "Diabetic Nephropathy" 1 => "SNP" 2 => "PPARγ" 3 => "ARMS-PCR" 4 => "Genetic models" ] ] ] "es" => array:1 [ 0 => array:4 [ "clase" => "keyword" "titulo" => "Palabras clave" "identificador" => "xpalclavsec1249389" "palabras" => array:5 [ 0 => "Nefropatía diabética" 1 => "PNU" 2 => "PPARγ" 3 => "RCP-ARMS" 4 => "Modelos genéticos" ] ] ] ] "tieneResumen" => true "resumen" => array:2 [ "en" => array:3 [ "titulo" => "Abstract" "resumen" => "BackgroundDiabetic Nephropathy (DN) is a major complication of Type 2 Diabetes Mellitus (T2DM) with high morbidity rates worldwide. ObjectiveTo determine the association of PPARγ rs1801282 polymorphism in T2DM and DN in south Indian population. MethodsWe have conducted a case–control study to test the association of rs1801282 polymorphism with T2DM and DN in 424 subjects (DN=128; T2DM=148 and controls=148) belonging to the south Indian population using ARMS-PCR and Sanger sequencing method. Further, a meta-analysis was performed for rs1801282 polymorphism from the published literature retrieved from various electronic databases to determine the susceptibility among T2DM and DN across various ethnic populations under five genetic models. ResultsThe genotyping of rs1801282 polymorphism showed significant (p-value<0.05) association with DN and T2DM compared to controls. In the meta-analysis, no significant association (p-value>0.05) was noticed for rs1801282 with DN vs. controls in homozygote, heterozygote, allelic, recessive and dominant genetic models. However, a significant association was observed between rs1801282 SNP and T2DM under heterozygote (Jj vs JJ) genetic model with OR=0.56, (95%CI [0.43–0.74]), p≤0.0001 of Asian and Caucasian populations. ConclusionOverall analysis suggests that the rs1801282 polymorphism might be associated with DN and T2DM. More case–control studies on the PPARγ gene with a larger sample size including all the confounding factors are required to corroborate the findings from this meta-analysis." "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0005" "titulo" => "Background" ] 1 => array:2 [ "identificador" => "abst0010" "titulo" => "Objective" ] 2 => array:2 [ "identificador" => "abst0015" "titulo" => "Methods" ] 3 => array:2 [ "identificador" => "abst0020" "titulo" => "Results" ] 4 => array:2 [ "identificador" => "abst0025" "titulo" => "Conclusion" ] ] ] "es" => array:3 [ "titulo" => "Resumen" "resumen" => "AntecedentesLa nefropatía diabética (ND) es una complicación importante de la diabetes mellitus de tipo 2 (DMT2) con altas tasas de morbilidad mundial. ObjetivoDeterminar la asociación del polimorfismo rs1801282 de PPARγ en la DMT2 y la ND en la población del sur de India. MétodosHemos llevado a cabo un estudio de casos y controles para analizar la asociación del polimorfismo rs1801282 con la DMT2 y la ND en 424 sujetos (ND=128; DMT2=148 y controles=148) pertenecientes a la población del sur de India mediante RCP-ARMS y método de secuenciación de Sanger. Además, se realizó un metaanálisis para el polimorfismo de rs1801282 a partir de la literatura publicada en varias bases de datos electrónicas para determinar la sensibilidad entre la DMT2 y la ND en varias poblaciones étnicas con 5 modelos genéticos. ResultadosEl genotipado de polimorfismo rs1801282 demostró una asociación significativa (valor de p<0,05) con la ND y la DMT2 en comparación con los controles. En el metaanálisis no se observó asociación significativa (valor de p>0,05) de rs1801282 con la ND frente a los controles en modelos genéticos homocigóticos, heterocigóticos, alélicos, recesivos y dominantes. Sin embargo, se observó una asociación significativa entre el polimorfismo de nucleótido único (PNU) rs1801282 SNP y la DMT2 en el modelo genético heterocigótico (Jj frente a JJ) con OR=0,56, (IC del 95%: 0,43-0,74; p≤0,0001 de poblaciones asiáticas y caucásicas. ConclusiónEl análisis general sugiere que el polimorfismo rs1801282 puede asociarse a ND y a DMT2. Se precisan más estudios de casos y controles sobre el gen PPARγ con un tamaño de la muestra mayor que incluya todos los factores de confusión para corroborar los resultados de este metaanálisis." "secciones" => array:5 [ 0 => array:2 [ "identificador" => "abst0030" "titulo" => "Antecedentes" ] 1 => array:2 [ "identificador" => "abst0035" "titulo" => "Objetivo" ] 2 => array:2 [ "identificador" => "abst0040" "titulo" => "Métodos" ] 3 => array:2 [ "identificador" => "abst0045" "titulo" => "Resultados" ] 4 => array:2 [ "identificador" => "abst0050" "titulo" => "Conclusión" ] ] ] ] "NotaPie" => array:1 [ 0 => array:3 [ "etiqueta" => "1" "nota" => "Equally contributed." "identificador" => "fn0005" ] ] "apendice" => array:1 [ 0 => array:1 [ "seccion" => array:1 [ 0 => array:4 [ "apendice" => "The following are the supplementary data to this article:<elsevierMultimedia ident="upi0005"></elsevierMultimedia>" "etiqueta" => "Appendix A" "titulo" => "Supplementary data" "identificador" => "sec0115" ] ] ] ] "multimedia" => array:13 [ 0 => array:7 [ "identificador" => "fig0005" "etiqueta" => "Fig. 1" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr1.jpeg" "Alto" => 1344 "Ancho" => 3167 "Tamanyo" => 364741 ] ] "descripcion" => array:1 [ "en" => "DNA sequence electropherograms of rs1801282 polymorphism in the PPARγ gene. Examples of homozygous dominant (JJ genotype) and homozygous recessive (jj genotype) condition of the studied SNP." ] ] 1 => array:7 [ "identificador" => "fig0010" "etiqueta" => "Fig. 2" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr2.jpeg" "Alto" => 3085 "Ancho" => 3167 "Tamanyo" => 733734 ] ] "descripcion" => array:1 [ "en" => "Circos plot illustrating the chromosomal interactions among the current SNP (rs1801282) and its associated SNPs. The Circos plot (outer to inner) denotes chromatin states, annotated genes, histone modifications, transcription factors, rs1801282 variant with associated SNPs (r2)." ] ] 2 => array:7 [ "identificador" => "fig0015" "etiqueta" => "Fig. 3" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr3.jpeg" "Alto" => 3690 "Ancho" => 3167 "Tamanyo" => 1023682 ] ] "descripcion" => array:1 [ "en" => "Forest plots showing individual and pooled ORs (95% CI) of the risk for rs1801282 polymorphism with Diabetic Nephropathy and Type 2 Diabetes Mellitus. The Forest Plots provides an insignificant association between the PPARγ polymorphism with DN and T2DM under five genetic models. The error bars indicate 95% CIs. Squares represent individual studies in the meta-analysis. Diamonds represent the pooled OR." ] ] 3 => array:7 [ "identificador" => "fig0020" "etiqueta" => "Fig. 4" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr4.jpeg" "Alto" => 4500 "Ancho" => 2880 "Tamanyo" => 1258588 ] ] "descripcion" => array:1 [ "en" => "Forest plots showing individual and pooled ORs (95% CI) of the risk for rs1801282 polymorphism with Type 2 Diabetes Mellitus and controls. The Forest Plots provides an insignificant association between the PPARγ polymorphism with T2DM and controls under five genetic models. The error bars indicate 95% CIs. Solid squares represent individual studies included in the meta-analysis. Solid diamonds represent the pooled OR." ] ] 4 => array:7 [ "identificador" => "fig0025" "etiqueta" => "Fig. 5" "tipo" => "MULTIMEDIAFIGURA" "mostrarFloat" => true "mostrarDisplay" => false "figura" => array:1 [ 0 => array:4 [ "imagen" => "gr5.jpeg" "Alto" => 1213 "Ancho" => 3167 "Tamanyo" => 250571 ] ] "descripcion" => array:1 [ "en" => "Funnel plots of publication biases on the relationship of PPARγ (rs1801282) polymorphism. Funnel plots for publication bias (five genetic models). Each point indicates the individual study included in this meta-analysis. A) Diabetic Nephropathy and Type 2 Diabetes Mellitus B) Type 2 Diabetes Mellitus and Controls." ] ] 5 => array:8 [ "identificador" => "tbl0005" "etiqueta" => "Table 1" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at1" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "a IF-inner forward, IR-inner reverse, OF-outer forward, OR- outer reverse." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer-IDa \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer sequence (5′-3′) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Allele \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of base pairs \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Tm (°C) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Total length (Bp) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SNP-1 OF- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">AAACTGATGTCTTGACTCATGGGTGTATT \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">29 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">65 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">361 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SNP-1 OR- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GCAACGAGCTAAGCATTAAAATACTGGA \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">65 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SNP-1 IF- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GAAACTCTGGGAGATTCTCCTATTGTCC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">28 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">65 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">221 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">SNP-1 IR- \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GTATCAGTGAAGGAATCGCTTTCAGC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">65 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">194 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2333885.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Designed primers for PPARγ (rs1801282) genotyping." ] ] 6 => array:8 [ "identificador" => "tbl0010" "etiqueta" => "Table 2" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at2" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "Data are presented as mean±SD." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Factors \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Diabetic nephropathy (N=128) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Type 2 diabetes mellitus(N= 148) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls (N=148) \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Men:women \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">106:22 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">96:52 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">110:38 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Mean Age (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">56.26±8.9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54.75±6.37 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54.15±7.50 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Body mass index (kg/m2) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">21.09±3.3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">26.23±3.68 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">23.08±2.37 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Duration of diabetes (years) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">11.4±5.97 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">6.65±4.61 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Nil \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Family history of diabetes (%) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">77 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">33 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Controlling insulin levels</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Oral hypoglycaemic drugs \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">108 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Nil \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Insulin \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">74 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">40 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Nil \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Food habits</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Vegetarian \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">20 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">44 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">30 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Non-vegetarian \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">108 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">104 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">118 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="4" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Physical activity (30min/day) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">18 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2333880.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Demographic and base-line clinical characteristics of DN, T2DMand Controls." ] ] 7 => array:8 [ "identificador" => "tbl0015" "etiqueta" => "Table 3" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at3" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "HWE, Hardy–Weinberg equilibrium, OR, Odd's ratio; χ2, Chi-square; p value-one tailed test." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Polymorphism \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequencies \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Diabetic nephropathy n=128 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Type 2 diabetes mellitus n=148 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">95% CI \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">χ2 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p-Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">rs1801282 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">210 (82.03) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">240 (81.08) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.431 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46 (17.96) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">56 (18.91) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.93 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.60–1.44 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Genotype \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">94 (73.43) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100 (67.56) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.147 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.19 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.049<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22 (17.18) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">40 (27.02) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.19 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.75–1.98 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 (09.37) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">08 (05.40) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.72 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.96–7.67 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.74 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.047<a class="elsevierStyleCrossRef" href="#tblfn0005">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="9" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="9" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Genetic model</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Dominant \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CG+GG vs CC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.78–2.23 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.175 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Recessive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG vs CC+CG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.81 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.71–4.57 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.61 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.150 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2333882.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0005" "etiqueta" => "*" "nota" => "Significant p-value." ] ] ] "descripcion" => array:1 [ "en" => "Association of the PPARγ Gene polymorphism with DN and T2DM." ] ] 8 => array:8 [ "identificador" => "tbl0020" "etiqueta" => "Table 4" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at4" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "HWE, Hardy–Weinberg equilibrium; OR, Odd's ratio; χ2, Chi-square; p-value-one tailed test." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Polymorphism \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequencies \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Type 2 diabetes mellitus n=148 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls n=148 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">95% CI \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">χ2 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p-Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">rs1801282 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">240 (81.08) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">264 (89.18) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4.69 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.003<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">56 (18.91) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 (10.81) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.92 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.20–3.07 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Genotype \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100 (67.56) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">120 (81.08) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.052 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.76 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.011<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">40 (27.02) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">24 (16.21) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.00 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.12–3.54 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">08 (05.40) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">04 (02.70) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.20 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.32–4.41 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.528 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="9" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="9" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Genetic model</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Dominant \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CG+GG vs CC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.48 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.28–3.83 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">7.08 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.005<a class="elsevierStyleCrossRef" href="#tblfn0010">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Recessive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG vs CC+CG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.05 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.60–6.98 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.39 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.188 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2333883.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0010" "etiqueta" => "*" "nota" => "Significant p-value." ] ] ] "descripcion" => array:1 [ "en" => "Association of the PPARγ Gene polymorphism with T2DM and controls." ] ] 9 => array:8 [ "identificador" => "tbl0025" "etiqueta" => "Table 5" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at5" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:3 [ "leyenda" => "HWE, Hardy–Weinberg equilibrium; OR, Odd's ratio; χ2, Chi-square; p-value-one tailed test." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Polymorphism \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequencies \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Diabetic nephropathy n=128 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls n=148 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">95% CI \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">χ2 \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">p-Value \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">rs1801282 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Allele \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">C \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">210 (82.03) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">264 (89.18) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.80 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.011<a class="elsevierStyleCrossRef" href="#tblfn0015">*</a> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">G \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46 (17.96) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">32 (10.81) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.80 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.13–2.93 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Genotype \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">94 (73.43) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">120 (81.08) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.052 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Reference \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.63 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.373 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">22 (17.18) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">24 (16.21) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.17 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.61–2.21 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">12 (09.37) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">04 (02.70) \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="" valign="\n \t\t\t\t\ttop\n \t\t\t\t"> \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.27 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.91–4.61 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.54 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.061 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="9" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t"></td></tr><tr title="table-row"><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " colspan="9" align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Genetic model</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Dominant \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">CG+GG vs CC \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.36–1.13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.30 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.085 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Recessive \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">GG vs CC+CG \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">– \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.72 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.17–6.34 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">5.60 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.169 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2333879.png" ] ] ] "notaPie" => array:1 [ 0 => array:3 [ "identificador" => "tblfn0015" "etiqueta" => "*" "nota" => "Significant p-value." ] ] ] "descripcion" => array:1 [ "en" => "Association of the PPARγ gene polymorphism with DN and controls." ] ] 10 => array:8 [ "identificador" => "tbl0030" "etiqueta" => "Table 6" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at6" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "a HWE, Hardy–Weinberg equilibrium." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Study name \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases (CC/CG/GG) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls (CC/CG/GG) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases (C/G-Allele) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls (C/G-Allele) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of cases \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of controls \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWEa \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Chi-square \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Bhaskar et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">14/29/11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">24/30/13 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">57/51 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">78/56 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">67 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.5143 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.425 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Erdogan et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">37/6/0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">39/7/2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">80/6 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">85/11 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">43 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">48 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.0513 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.797 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Maeda et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">55/24/0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">46/15/0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">134/24 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">107/15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">79 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">61 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.273 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.198 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">This study et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">94/22/12 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100/40/8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">210/46 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">240/56 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">128 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">148 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.147 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.097 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Wu et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">130/76/9 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">93/70/15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">336/94 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">256/100 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">215 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">178 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.723 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.125 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2333881.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Genotype and allele frequencies of PPARγ gene polymorphism with DN and T2DM." ] ] 11 => array:8 [ "identificador" => "tbl0035" "etiqueta" => "Table 7" "tipo" => "MULTIMEDIATABLA" "mostrarFloat" => true "mostrarDisplay" => false "detalles" => array:1 [ 0 => array:3 [ "identificador" => "at7" "detalle" => "Table " "rol" => "short" ] ] "tabla" => array:2 [ "leyenda" => "a HWE, Hardy–Weinberg equilibrium." "tablatextoimagen" => array:1 [ 0 => array:2 [ "tabla" => array:1 [ 0 => """ <table border="0" frame="\n \t\t\t\t\tvoid\n \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Study Name \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases (CC/CG/GG) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls (CC/CG/GG) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases (C/G-Allele) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls (C/G-Allele) \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of cases \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of controls \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWEa \t\t\t\t\t\t\n \t\t\t\t\t\t</th><th class="td" title="\n \t\t\t\t\ttable-head\n \t\t\t\t " align="center" valign="\n \t\t\t\t\ttop\n \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Chi-square \t\t\t\t\t\t\n \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Deeb et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">87/4/0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">45/8/1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">178/4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">98/10 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">91 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">54 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.384 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.756 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Hara et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">400/15/0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">496/45/0 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">815/15 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1037/45 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">415 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">541 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.312 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.368 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Lin et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1348/178/3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1328/107/4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2874/184 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2763/115 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1529 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1439 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.242 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.368 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Mori et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2097/103/3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1114/96/2 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">4297/109 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2324/100 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2203 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1212 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.214 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.539 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Pattanayak et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">158/37/5 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">167/30/3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">353/47 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">364/36 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">200 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">200 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.233 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1.419 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Phani et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">155/253/181 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">181/254/83 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">563/615 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">616/420 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">589 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">518 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.361 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.831 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Tripathi et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">156/33/1 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">154/48/8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">345/35 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">356/64 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">190 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">210 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.095 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.785 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">This study et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">100/40/8 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">120/24/4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">240/56 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">264/32 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">148 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">148 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.005 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">3.74 \t\t\t\t\t\t\n \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">Vimaleswaran et al. \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">860/136/4 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">840/157/3 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1856/144 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="left" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1837/163 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">1000 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">0.129 \t\t\t\t\t\t\n \t\t\t\t</td><td class="td" title="\n \t\t\t\t\ttable-entry\n \t\t\t\t " align="char" valign="\n \t\t\t\t\ttop\n \t\t\t\t">2.301 \t\t\t\t\t\t\n \t\t\t\t</td></tr></tbody></table> """ ] "imagenFichero" => array:1 [ 0 => "xTab2333884.png" ] ] ] ] "descripcion" => array:1 [ "en" => "Genotype and allele frequencies of PPARγ gene polymorphism with T2DM and controls." ] ] 12 => array:5 [ "identificador" => "upi0005" "tipo" => "MULTIMEDIAECOMPONENTE" "mostrarFloat" => false "mostrarDisplay" => true "Ecomponente" => array:2 [ "fichero" => "mmc1.docx" "ficheroTamanyo" => 21374 ] ] ] "bibliografia" => array:2 [ "titulo" => "References" "seccion" => array:1 [ 0 => array:2 [ "identificador" => "bibs0015" "bibliografiaReferencia" => array:37 [ 0 => array:3 [ "identificador" => "bib0190" "etiqueta" => "1" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic approaches to the molecular understanding of type 2 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "M.I. McCarthy" 1 => "P. Froguel" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Am J Physiol-Endocrinol Metab" "fecha" => "2002" "volumen" => "283" "paginaInicial" => "E25" "paginaFinal" => "E217" ] ] ] ] ] ] 1 => array:3 [ "identificador" => "bib0195" "etiqueta" => "2" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Markers of and risk factors for the development and progression of diabetic kidney disease" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "R.J. MacIsaac" 1 => "E.I. Ekinci" 2 => "G. Jerums" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1053/j.ajkd.2013.10.048" "Revista" => array:7 [ "tituloSerie" => "Am J Kidney Dis" "fecha" => "2014" "volumen" => "63" "paginaInicial" => "S39" "paginaFinal" => "S62" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24461729" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S2213858716303205" "estado" => "S300" "issn" => "22138587" ] ] ] ] ] ] ] 2 => array:3 [ "identificador" => "bib0200" "etiqueta" => "3" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A glimpse of various pathogenetic mechanisms of diabetic nephropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "Y.S. Kanwar" 1 => "L. Sun" 2 => "P. Xie" 3 => "Liu F-y" 4 => "S. Chen" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1146/annurev.pathol.4.110807.092150" "Revista" => array:6 [ "tituloSerie" => "Annu Rev Pathol" "fecha" => "2011" "volumen" => "6" "paginaInicial" => "395" "paginaFinal" => "423" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21261520" "web" => "Medline" ] ] ] ] ] ] ] ] 3 => array:3 [ "identificador" => "bib0205" "etiqueta" => "4" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genetic associations in diabetic nephropathy: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Mooyaart" 1 => "E. Valk" 2 => "L. Van Es" 3 => "J. Bruijn" 4 => "E. De Heer" 5 => "B. Freedman" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1007/s00125-010-1996-1" "Revista" => array:7 [ "tituloSerie" => "Diabetologia" "fecha" => "2011" "volumen" => "54" "paginaInicial" => "544" "paginaFinal" => "553" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21127830" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0168822712002094" "estado" => "S300" "issn" => "01688227" ] ] ] ] ] ] ] 4 => array:3 [ "identificador" => "bib0210" "etiqueta" => "5" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Genome-wide association study in individuals of South Asian ancestry identifies six new type 2 diabetes susceptibility loci" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "J.S. Kooner" 1 => "D. Saleheen" 2 => "X. Sim" 3 => "J. Sehmi" 4 => "W. Zhang" 5 => "P. Frossard" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/ng.921" "Revista" => array:5 [ "tituloSerie" => "Nat Genet" "fecha" => "2011" "volumen" => "43" "paginaInicial" => "984" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21874001" "web" => "Medline" ] ] ] ] ] ] ] ] 5 => array:3 [ "identificador" => "bib0215" "etiqueta" => "6" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Two new Loci for body-weight regulation identified in a joint analysis of genome-wide association studies for early-onset extreme obesity in French and german study groups" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A. Scherag" 1 => "C. Dina" 2 => "A. Hinney" 3 => "V. Vatin" 4 => "S. Scherag" 5 => "C.I. Vogel" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pgen.1000916" "Revista" => array:5 [ "tituloSerie" => "PLoS Genet" "fecha" => "2010" "volumen" => "6" "paginaInicial" => "e1000916" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20421936" "web" => "Medline" ] ] ] ] ] ] ] ] 6 => array:3 [ "identificador" => "bib0220" "etiqueta" => "7" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Associations between PPARG polymorphisms and the risk of essential hypertension" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "G. Cai" 1 => "X. Zhang" 2 => "W. Weng" 3 => "G. Shi" 4 => "S. Xue" 5 => "B. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1371/journal.pone.0181644" "Revista" => array:5 [ "tituloSerie" => "PLOS ONE" "fecha" => "2017" "volumen" => "12" "paginaInicial" => "e0181644" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28727849" "web" => "Medline" ] ] ] ] ] ] ] ] 7 => array:3 [ "identificador" => "bib0225" "etiqueta" => "8" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Ensembl genome browser. Vogel and Motulsky's Human Genetics" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "X.M. Fernández" 1 => "E. Birney" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "fecha" => "2010" "paginaInicial" => "923" "paginaFinal" => "939" "editorial" => "Springer" ] ] ] ] ] ] 8 => array:3 [ "identificador" => "bib0230" "etiqueta" => "9" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Peroxisome proliferator-activated receptor γ polymorphism Pro12Ala is associated with nephropathy in type 2 diabetes: evidence from meta-analysis of 18 studies" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Zhang" 1 => "S. Zhu" 2 => "J. Chen" 3 => "Y. Tang" 4 => "H. Hu" 5 => "V. Mohan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Diabetes Care" "fecha" => "2012" "volumen" => "2" "paginaInicial" => "1388" "paginaFinal" => "1393" ] ] ] ] ] ] 9 => array:3 [ "identificador" => "bib0235" "etiqueta" => "10" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of peroxisome proliferator-activated receptor-γ in maintenance of the characteristics of mature 3T3-L1 adipocytes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "Y. Tamori" 1 => "J. Masugi" 2 => "N. Nishino" 3 => "M. Kasuga" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2337/diabetes.51.7.2045" "Revista" => array:6 [ "tituloSerie" => "Diabetes" "fecha" => "2002" "volumen" => "51" "paginaInicial" => "2045" "paginaFinal" => "2055" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12086932" "web" => "Medline" ] ] ] ] ] ] ] ] 10 => array:3 [ "identificador" => "bib0240" "etiqueta" => "11" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The common PPARγ Pro12Ala polymorphism is associated with decreased risk of type 2 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "D. Altshuler" 1 => "J.N. Hirschhorn" 2 => "M. Klannemark" 3 => "C.M. Lindgren" 4 => "M.-C. Vohl" 5 => "J. Nemesh" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/79216" "Revista" => array:5 [ "tituloSerie" => "Nat Genet" "fecha" => "2000" "volumen" => "26" "paginaInicial" => "76" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10973253" "web" => "Medline" ] ] ] ] ] ] ] ] 11 => array:3 [ "identificador" => "bib0245" "etiqueta" => "12" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The impact of ethnicity on type 2 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "N. Abate" 1 => "M. Chandalia" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Diab Compl" "fecha" => "2003" "volumen" => "17" "paginaInicial" => "39" "paginaFinal" => "58" ] ] ] ] ] ] 12 => array:3 [ "identificador" => "bib0250" "etiqueta" => "13" "referencia" => array:1 [ 0 => array:1 [ "referenciaCompleta" => "World Health Organization. Definition, diagnosis and classification of diabetes mellitus and its complications: report of a WHO consultation. Part-1, Diagnosis and classification of diabetes mellitus. 1999." ] ] ] 13 => array:3 [ "identificador" => "bib0255" "etiqueta" => "14" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The isolation of high molecular weight eukaryotic DNA. Nucleic Acids" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:1 [ 0 => "C. Mathew" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Libro" => array:4 [ "fecha" => "1984" "paginaInicial" => "4" "paginaFinal" => "31" "editorial" => "Springer" ] ] ] ] ] ] 14 => array:3 [ "identificador" => "bib0260" "etiqueta" => "15" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "An efficient procedure for genotyping single nucleotide polymorphisms" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "S. Ye" 1 => "S. Dhillon" 2 => "X. Ke" 3 => "A.R. Collins" 4 => "I.N. Day" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/nar/29.17.e88" "Revista" => array:6 [ "tituloSerie" => "Nucleic Acids Res" "fecha" => "2001" "volumen" => "29" "paginaInicial" => "e88" "paginaFinal" => "e90" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11522844" "web" => "Medline" ] ] ] ] ] ] ] ] 15 => array:3 [ "identificador" => "bib0265" "etiqueta" => "16" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association between NOS1 gene polymorphisms and Schizophrenia in Asian and Caucasian populations: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S.S. Ahmed" 1 => "R.A. Husain" 2 => "S. Kumar" 3 => "V. Ramakrishnan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:6 [ "tituloSerie" => "Neuromol Med" "fecha" => "2017" "volumen" => "19" "paginaInicial" => "452" "paginaFinal" => "461" "itemHostRev" => array:3 [ "pii" => "S2213858716303205" "estado" => "S300" "issn" => "22138587" ] ] ] ] ] ] ] 16 => array:3 [ "identificador" => "bib0270" "etiqueta" => "17" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of rs1801582 and rs1801334 PARK2 polymorphisms with risk of Parkinson's disease: a case–control study in South India and meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "V. Ramakrishnan" 1 => "T.A. Alphonsa" 2 => "R.A. Husain" 3 => "S.S. Ahmed" 4 => "K. Subramaniyan" 5 => "S. Kumar" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Meta Gene" "fecha" => "2016" "volumen" => "10" "paginaInicial" => "32" "paginaFinal" => "38" ] ] ] ] ] ] 17 => array:3 [ "identificador" => "bib0275" "etiqueta" => "18" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Predicting the extent of heterogeneity in meta-analysis, using empirical data from the Cochrane Database of Systematic Reviews" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "R.M. Turner" 1 => "J. Davey" 2 => "M.J. Clarke" 3 => "S.G. Thompson" 4 => "J.P. Higgins" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/ije/dys041" "Revista" => array:6 [ "tituloSerie" => "Int J Epidemiol" "fecha" => "2012" "volumen" => "41" "paginaInicial" => "818" "paginaFinal" => "827" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22461129" "web" => "Medline" ] ] ] ] ] ] ] ] 18 => array:3 [ "identificador" => "bib0280" "etiqueta" => "19" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Meta-analysis in clinical trials revisited" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:2 [ 0 => "R. DerSimonian" 1 => "N. Laird" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cct.2015.09.002" "Revista" => array:7 [ "tituloSerie" => "Contemp Clin Trials" "fecha" => "2015" "volumen" => "45" "paginaInicial" => "139" "paginaFinal" => "145" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26343745" "web" => "Medline" ] ] "itemHostRev" => array:3 [ "pii" => "S0022347613015618" "estado" => "S300" "issn" => "00223476" ] ] ] ] ] ] ] 19 => array:3 [ "identificador" => "bib0285" "etiqueta" => "20" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Bias in meta-analysis detected by a simple, graphical test" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "M. Egger" 1 => "G.D. Smith" 2 => "M. Schneider" 3 => "C. Minder" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1136/bmj.315.7109.629" "Revista" => array:6 [ "tituloSerie" => "BMJ" "fecha" => "1997" "volumen" => "315" "paginaInicial" => "629" "paginaFinal" => "634" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9310563" "web" => "Medline" ] ] ] ] ] ] ] ] 20 => array:3 [ "identificador" => "bib0290" "etiqueta" => "21" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "PSEN1 gene polymorphisms in Caucasian Alzheimer's disease: a meta-analysis" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "V. Ramakrishnan" 1 => "R.A. Husain" 2 => "S.S. Ahmed" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.cca.2017.08.016" "Revista" => array:6 [ "tituloSerie" => "Clin Chim Acta" "fecha" => "2017" "volumen" => "473" "paginaInicial" => "65" "paginaFinal" => "70" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28821390" "web" => "Medline" ] ] ] ] ] ] ] ] 21 => array:3 [ "identificador" => "bib0295" "etiqueta" => "22" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of the ACE ID and PPARG P12A polymorphisms in genetic susceptibility of diabetic nephropathy in a South Indian population" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "L.V. Bhaskar" 1 => "S. Mahin" 2 => "R.T. Ginila" 3 => "P. Soundararajan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Nephro-urology" "fecha" => "2013" "volumen" => "5" "paginaInicial" => "813" ] ] ] ] ] ] 22 => array:3 [ "identificador" => "bib0300" "etiqueta" => "23" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The relationship of the peroxisome proliferator-activated receptor-gamma 2 exon 2 and exon 6 gene polymorphism in Turkish type 2 diabetic patients with and without nephropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "M. Erdogan" 1 => "M. Karadeniz" 2 => "Z. Eroglu" 3 => "B. Tezcanlı" 4 => "N. Selvi" 5 => "C. Yilmaz" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Diab Res Clin Pract" "fecha" => "2007" "volumen" => "78" "paginaInicial" => "355" "paginaFinal" => "359" ] ] ] ] ] ] 23 => array:3 [ "identificador" => "bib0305" "etiqueta" => "24" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Peroxisome proliferator-activated receptor γ gene polymorphism is associated with serum triglyceride levels and body mass index in Japanese type 2 diabetic patients" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "A. Maeda" 1 => "T. Gohda" 2 => "K. Funabiki" 3 => "S. Horikoshi" 4 => "Y. Tomino" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1002/jcla.20045" "Revista" => array:6 [ "tituloSerie" => "J Clin Lab Anal" "fecha" => "2004" "volumen" => "18" "paginaInicial" => "317" "paginaFinal" => "321" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15543562" "web" => "Medline" ] ] ] ] ] ] ] ] 24 => array:3 [ "identificador" => "bib0310" "etiqueta" => "25" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association and interaction analyses of genetic variants in ADIPOQ, ENPP1, GHSR PPARγ and TCF7L2 genes for diabetic nephropathy in a Taiwanese population with type 2 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "L.S.-H. Wu" 1 => "C.-H. Hsieh" 2 => "D. Pei" 3 => "Y.-J. Hung" 4 => "S.-W. Kuo" 5 => "E. Lin" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1093/ndt/gfp271" "Revista" => array:6 [ "tituloSerie" => "Nephrol Dial Transplant" "fecha" => "2009" "volumen" => "24" "paginaInicial" => "3360" "paginaFinal" => "3366" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19506043" "web" => "Medline" ] ] ] ] ] ] ] ] 25 => array:3 [ "identificador" => "bib0315" "etiqueta" => "26" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "A Pro12Ala substitution in PPARγ2 associated with decreased receptor activity, lower body mass index and improved insulin sensitivity" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "S.S. Deeb" 1 => "L. Fajas" 2 => "M. Nemoto" 3 => "J. Pihlajamäki" 4 => "L. Mykkänen" 5 => "J. Kuusisto" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1038/3099" "Revista" => array:5 [ "tituloSerie" => "Nat Genet" "fecha" => "1998" "volumen" => "20" "paginaInicial" => "284" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9806549" "web" => "Medline" ] ] ] ] ] ] ] ] 26 => array:3 [ "identificador" => "bib0320" "etiqueta" => "27" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Pro12Ala polymorphism in PPAR γ2 may confer resistance to type 2 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K. Hara" 1 => "T. Okada" 2 => "K. Tobe" 3 => "K. Yasuda" 4 => "Y. Mori" 5 => "H. Kadowaki" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Biochem Biophys Res Commun" "fecha" => "2000" "volumen" => "271" "paginaInicial" => "212" "paginaFinal" => "216" ] ] ] ] ] ] 27 => array:3 [ "identificador" => "bib0325" "etiqueta" => "28" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association study of genetic variants in eight genes/loci with type 2 diabetes in a Han Chinese population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Y. Lin" 1 => "P. Li" 2 => "L. Cai" 3 => "B. Zhang" 4 => "X. Tang" 5 => "X. Zhang" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1186/1471-2350-11-97" "Revista" => array:5 [ "tituloSerie" => "BMC Med Genet" "fecha" => "2010" "volumen" => "11" "paginaInicial" => "97" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20550665" "web" => "Medline" ] ] ] ] ] ] ] ] 28 => array:3 [ "identificador" => "bib0330" "etiqueta" => "29" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The Pro12→ Ala substitution in PPAR-γ is associated with resistance to development of diabetes in the general population: possible involvement in impairment of insulin secretion in individuals with type 2 diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "H. Mori" 1 => "H. Ikegami" 2 => "Y. Kawaguchi" 3 => "S. Seino" 4 => "N. Yokoi" 5 => "J. Takeda" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.2337/diabetes.50.4.891" "Revista" => array:6 [ "tituloSerie" => "Diabetes" "fecha" => "2001" "volumen" => "50" "paginaInicial" => "891" "paginaFinal" => "894" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11289058" "web" => "Medline" ] ] ] ] ] ] ] ] 29 => array:3 [ "identificador" => "bib0335" "etiqueta" => "30" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Role of peroxisome proliferator-activated receptor gamma gene polymorphisms in type 2 diabetes mellitus patients of West Bengal, India" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:6 [ 0 => "A.K. Pattanayak" 1 => "B. Bankura" 2 => "N. Balmiki" 3 => "T.K. Das" 4 => "S. Chowdhury" 5 => "M. Das" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "J Diab Invest" "fecha" => "2014" "volumen" => "5" "paginaInicial" => "188" "paginaFinal" => "191" ] ] ] ] ] ] 30 => array:3 [ "identificador" => "bib0340" "etiqueta" => "31" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Implications of critical PPARγ2 ADIPOQ and FTO gene polymorphisms in type 2 diabetes and obesity-mediated susceptibility to type 2 diabetes in an Indian population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "N.M. Phani" 1 => "M. Vohra" 2 => "S. Rajesh" 3 => "P. Adhikari" 4 => "S.K. Nagri" 5 => "S.C. D'Souza" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Mol Genet Genom" "fecha" => "2016" "volumen" => "291" "paginaInicial" => "193" "paginaFinal" => "204" ] ] ] ] ] ] 31 => array:3 [ "identificador" => "bib0345" "etiqueta" => "32" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Type 2 diabetes in a central Indian population: association with PPARG2 P121A allele but not ENPP1 K121Q" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "A.K. Tripathi" 1 => "S. Shukla" 2 => "M.K. Dwivedi" 3 => "J.K. Tripathi" 4 => "U.K. Chauhan" 5 => "M. Indurkar" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Adv Genomics Genet" "fecha" => "2013" "volumen" => "3" "paginaInicial" => "1" "paginaFinal" => "9" ] ] ] ] ] ] 32 => array:3 [ "identificador" => "bib0350" "etiqueta" => "33" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Evidence for an association with type 2 diabetes mellitus at the PPARG locus in a South Indian population" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "K.S. Vimaleswaran" 1 => "V. Radha" 2 => "M.G. Jayapriya" 3 => "S. Ghosh" 4 => "P.P. Majumder" 5 => "M.S. Rao" ] ] ] ] ] "host" => array:1 [ 0 => array:2 [ "doi" => "10.1016/j.metabol.2009.07.034" "Revista" => array:6 [ "tituloSerie" => "Metab-Clin Exp" "fecha" => "2010" "volumen" => "59" "paginaInicial" => "457" "paginaFinal" => "462" "link" => array:1 [ 0 => array:2 [ "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19846173" "web" => "Medline" ] ] ] ] ] ] ] ] 33 => array:3 [ "identificador" => "bib0355" "etiqueta" => "34" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "Association of the PPARGC1A gene polymorphism with diabetic nephropathy in an Asian Indian population (CURES-41)" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:4 [ 0 => "S.B. Gayathri" 1 => "V. Radha" 2 => "K.S. Vimaleswaran" 3 => "V. Mohan" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:5 [ "tituloSerie" => "Metab Syndrome Relat Disord" "fecha" => "2010" "volumen" => "8" "paginaInicial" => "119" "paginaFinal" => "126" ] ] ] ] ] ] 34 => array:3 [ "identificador" => "bib0360" "etiqueta" => "35" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The role of peroxisome proliferator-activated receptors and their transcriptional coactivators gene variations in human trainability: a systematic review" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:5 [ 0 => "M. Petr" 1 => "P. Stastny" 2 => "A. Zajac" 3 => "J.J. Tufano" 4 => "A. Maciejewska-Skrendo" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:4 [ "tituloSerie" => "Int J Mol Sci" "fecha" => "2018" "volumen" => "19" "paginaInicial" => "1472" ] ] ] ] ] ] 35 => array:3 [ "identificador" => "bib0365" "etiqueta" => "36" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "New insights into the PPARγ agonists for the treatment of diabetic nephropathy" "autores" => array:1 [ 0 => array:2 [ "etal" => true "autores" => array:6 [ 0 => "Z. Jia" 1 => "Y. Sun" 2 => "G. Yang" 3 => "A. Zhang" 4 => "S. Huang" 5 => "K.M. Heiney" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:2 [ "tituloSerie" => "PPAR Res" "fecha" => "2014" ] ] ] ] ] ] 36 => array:3 [ "identificador" => "bib0370" "etiqueta" => "37" "referencia" => array:1 [ 0 => array:2 [ "contribucion" => array:1 [ 0 => array:2 [ "titulo" => "The renoprotective actions of peroxisome proliferator-activated receptors agonists in diabetes" "autores" => array:1 [ 0 => array:2 [ "etal" => false "autores" => array:3 [ 0 => "M.C. Thomas" 1 => "K.A. Jandeleit-Dahm" 2 => "C. Tikellis" ] ] ] ] ] "host" => array:1 [ 0 => array:1 [ "Revista" => array:2 [ "tituloSerie" => "PPAR Res" "fecha" => "2012" ] ] ] ] ] ] ] ] ] ] "agradecimientos" => array:1 [ 0 => array:4 [ "identificador" => "xack471369" "titulo" => "Acknowledgment" "texto" => "All the authors were thankful to the patients and controls for participating in the study. The author (AH) wishes to acknowledge the Chettinad Academy of Research and Education (CARE) for providing the Chettinad Research fellowship." "vista" => "all" ] ] ] "idiomaDefecto" => "en" "url" => "/02116995/0000004000000003/v3_202007050614/S0211699520300345/v3_202007050614/en/main.assets" "Apartado" => array:4 [ "identificador" => "42448" "tipo" => "SECCION" "en" => array:2 [ "titulo" => "Originales" "idiomaDefecto" => true ] "idiomaDefecto" => "en" ] "PDF" => "https://static.elsevier.es/multimedia/02116995/0000004000000003/v3_202007050614/S0211699520300345/v3_202007050614/en/main.pdf?idApp=UINPBA000064&text.app=https://revistanefrologia.com/" "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699520300345?idApp=UINPBA000064"]

Estadísticas

Original article

Association between PPARγrs1801282 polymorphism with diabetic nephropathy and type-2 diabetes mellitus susceptibility in south India and a meta-analysis

Asociación entre el polimorfismo rs1801282 de PPARγ con nefropatía diabética y sensibilidad a la diabetes mellitus de tipo 2 en el sur de India y un metaanálisis

Ilibagiza Reginea,1, Rehman Syed Rasheed Akram Husaina,1, Rajagopalan P. Aswathia, D. Ramacharan Reddyb, Shiek S.S.J. Ahmedc, Veerabathiran Ramakrishnana,

Autor para correspondencia

rkgenes@gmail.com

Corresponding author.

a Genetics Lab, Faculty of Allied Health Sciences, Chettinad Academy of Research and Education, Kelambakkam, Tamil Nadu, India

b Department of General Medicine, Chettinad Hospital and Research Institute, Chettinad Health City, Kelambakkam, Tamil Nadu, India

c Drug Discovery Lab, Faculty of Allied Health Sciences, Chettinad Academy of Research and Education, Kelambakkam, Tamil Nadu, India

Leído

9020

Veces
se ha leído el artículo

2951

Total PDF

6069

Total HTML

Compartir estadísticas

 array:24 [
  "pii" => "S0211699520300345"
  "issn" => "02116995"
  "doi" => "10.1016/j.nefro.2020.01.005"
  "estado" => "S300"
  "fechaPublicacion" => "2020-05-01"
  "aid" => "705"
  "copyright" => "Sociedad Espa&#241;ola de Nefrolog&#237;a"
  "copyrightAnyo" => "2020"
  "documento" => "article"
  "crossmark" => 0
  "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
  "subdocumento" => "fla"
  "cita" => "Nefrologia. 2020;40:287-98"
  "abierto" => array:3 [
    "ES" => true
    "ES2" => true
    "LATM" => true
  ]
  "gratuito" => true
  "lecturas" => array:1 [
    "total" => 0
  ]
  "itemSiguiente" => array:18 [
    "pii" => "S021169951930178X"
    "issn" => "02116995"
    "doi" => "10.1016/j.nefro.2019.07.007"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "664"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Nefrologia. 2020;40:299-310"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:2 [
      "total" => 324
      "formatos" => array:3 [
        "EPUB" => 56
        "HTML" => 160
        "PDF" => 108
      ]
    ]
    "en" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "The impact of antiviral therapy for HCV on kidney disease&#58; a systematic review and meta-analysis"
      "tienePdf" => "en"
      "tieneTextoCompleto" => "en"
      "tieneResumen" => array:2 [
        0 => "en"
        1 => "es"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "299"
          "paginaFinal" => "310"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "es" => array:1 [
          "titulo" => "Impacto de la terapia antiviral para VHC en las enfermedades renales&#58; revisi&#243;n sistem&#225;tica y meta-an&#225;lisis"
        ]
      ]
      "contieneResumen" => array:2 [
        "en" => true
        "es" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "en" => true
      ]
      "contienePdf" => array:1 [
        "en" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0010"
          "etiqueta" => "Figure 2"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr2.jpeg"
              "Alto" => 1013
              "Ancho" => 2083
              "Tamanyo" => 78972
            ]
          ]
          "descripcion" => array:1 [
            "en" => "<p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">Funnel plot of precision by Log Ratio &#40;cohorts who received antiviral therapy <span class="elsevierStyleItalic">vs&#46;</span> those who did not&#59; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>8 studies&#44; <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>333&#44;312 unique patients&#41;&#46;</p>"
          ]
        ]
      ]
      "autores" => array:1 [
        0 => array:2 [
          "autoresLista" => "Fabrizio Fabrizi, Roberta Cerutti, Vivek Dixit, Piergiorgio Messa"
          "autores" => array:4 [
            0 => array:2 [
              "nombre" => "Fabrizio"
              "apellidos" => "Fabrizi"
            ]
            1 => array:2 [
              "nombre" => "Roberta"
              "apellidos" => "Cerutti"
            ]
            2 => array:2 [
              "nombre" => "Vivek"
              "apellidos" => "Dixit"
            ]
            3 => array:2 [
              "nombre" => "Piergiorgio"
              "apellidos" => "Messa"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "en"
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S021169951930178X?idApp=UINPBA000064"
    "url" => "/02116995/0000004000000003/v3_202007050614/S021169951930178X/v3_202007050614/en/main.assets"
  ]
  "itemAnterior" => array:20 [
    "pii" => "S0211699520300436"
    "issn" => "02116995"
    "doi" => "10.1016/j.nefro.2020.04.005"
    "estado" => "S300"
    "fechaPublicacion" => "2020-05-01"
    "aid" => "714"
    "copyright" => "Sociedad Espa&#241;ola de Nefrolog&#237;a"
    "documento" => "article"
    "crossmark" => 0
    "licencia" => "http://creativecommons.org/licenses/by-nc-nd/4.0/"
    "subdocumento" => "fla"
    "cita" => "Nefrologia. 2020;40:279-86"
    "abierto" => array:3 [
      "ES" => true
      "ES2" => true
      "LATM" => true
    ]
    "gratuito" => true
    "lecturas" => array:1 [
      "total" => 0
    ]
    "es" => array:13 [
      "idiomaDefecto" => true
      "cabecera" => "<span class="elsevierStyleTextfn">Original</span>"
      "titulo" => "Alta prevalencia de COVID-19 asintom&#225;tico en hemodi&#225;lisis&#46; Aprendiendo d&#237;a a d&#237;a el primer mes de pandemia de COVID-19"
      "tienePdf" => "es"
      "tieneTextoCompleto" => "es"
      "tieneResumen" => array:2 [
        0 => "es"
        1 => "en"
      ]
      "paginas" => array:1 [
        0 => array:2 [
          "paginaInicial" => "279"
          "paginaFinal" => "286"
        ]
      ]
      "titulosAlternativos" => array:1 [
        "en" => array:1 [
          "titulo" => "High prevalence of asymptomatic COVID-19 in haemodialysis&#58; learning day by day in the first month of the COVID-19 pandemic"
        ]
      ]
      "contieneResumen" => array:2 [
        "es" => true
        "en" => true
      ]
      "contieneTextoCompleto" => array:1 [
        "es" => true
      ]
      "contienePdf" => array:1 [
        "es" => true
      ]
      "resumenGrafico" => array:2 [
        "original" => 0
        "multimedia" => array:7 [
          "identificador" => "fig0005"
          "etiqueta" => "Figura 1"
          "tipo" => "MULTIMEDIAFIGURA"
          "mostrarFloat" => true
          "mostrarDisplay" => false
          "figura" => array:1 [
            0 => array:4 [
              "imagen" => "gr1.jpeg"
              "Alto" => 1253
              "Ancho" => 2167
              "Tamanyo" => 138720
            ]
          ]
          "descripcion" => array:1 [
            "es" => "<p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Evoluci&#243;n diaria de PCR-SARS-CoV-2 donde se recogen los datos positivos y negativos por cl&#237;nica y los positivos detectados por cribado&#46;</p>"
          ]
        ]
      ]
      "autores" => array:2 [
        0 => array:2 [
          "autoresLista" => "Marta Albalate, Patricia Arribas, Esther Torres, Melissa Cintra, Roberto Alc&#225;zar, Marta Puerta, Mayra Ortega, Fabio Procaccini, Juan Martin, Eva Jim&#233;nez, In&#233;s Fernandez, Patricia de Sequera"
          "autores" => array:13 [
            0 => array:2 [
              "nombre" => "Marta"
              "apellidos" => "Albalate"
            ]
            1 => array:2 [
              "nombre" => "Patricia"
              "apellidos" => "Arribas"
            ]
            2 => array:2 [
              "nombre" => "Esther"
              "apellidos" => "Torres"
            ]
            3 => array:2 [
              "nombre" => "Melissa"
              "apellidos" => "Cintra"
            ]
            4 => array:2 [
              "nombre" => "Roberto"
              "apellidos" => "Alc&#225;zar"
            ]
            5 => array:2 [
              "nombre" => "Marta"
              "apellidos" => "Puerta"
            ]
            6 => array:2 [
              "nombre" => "Mayra"
              "apellidos" => "Ortega"
            ]
            7 => array:2 [
              "nombre" => "Fabio"
              "apellidos" => "Procaccini"
            ]
            8 => array:2 [
              "nombre" => "Juan"
              "apellidos" => "Martin"
            ]
            9 => array:2 [
              "nombre" => "Eva"
              "apellidos" => "Jim&#233;nez"
            ]
            10 => array:2 [
              "nombre" => "In&#233;s"
              "apellidos" => "Fernandez"
            ]
            11 => array:2 [
              "nombre" => "Patricia"
              "apellidos" => "de Sequera"
            ]
            12 => array:1 [
              "colaborador" => "Grupo de Enfermer&#237;a HUIL"
            ]
          ]
        ]
        1 => array:2 [
          "autoresLista" => ""
          "autores" => array:1 [
            0 => array:1 [
              "colaborador" => "Grupo enfermer&#237;a HUIL"
            ]
          ]
        ]
      ]
    ]
    "idiomaDefecto" => "es"
    "Traduccion" => array:1 [
      "en" => array:9 [
        "pii" => "S2013251420300754"
        "doi" => "10.1016/j.nefroe.2020.06.013"
        "estado" => "S300"
        "subdocumento" => ""
        "abierto" => array:3 [
          "ES" => true
          "ES2" => true
          "LATM" => true
        ]
        "gratuito" => true
        "lecturas" => array:1 [
          "total" => 0
        ]
        "idiomaDefecto" => "en"
        "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S2013251420300754?idApp=UINPBA000064"
      ]
    ]
    "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699520300436?idApp=UINPBA000064"
    "url" => "/02116995/0000004000000003/v3_202007050614/S0211699520300436/v3_202007050614/es/main.assets"
  ]
  "en" => array:22 [
    "idiomaDefecto" => true
    "cabecera" => "<span class="elsevierStyleTextfn">Original article</span>"
    "titulo" => "Association between <span class="elsevierStyleItalic">PPAR&#947;</span><span class="elsevierStyleItalic">rs1801282</span> polymorphism with diabetic nephropathy and type-2 diabetes mellitus susceptibility in south India and a meta-analysis"
    "tieneTextoCompleto" => true
    "paginas" => array:1 [
      0 => array:2 [
        "paginaInicial" => "287"
        "paginaFinal" => "298"
      ]
    ]
    "autores" => array:1 [
      0 => array:4 [
        "autoresLista" => "Ilibagiza Regine, Rehman Syed Rasheed Akram Husain, Rajagopalan P&#46; Aswathi, D&#46; Ramacharan Reddy, Shiek S&#46;S&#46;J&#46; Ahmed, Veerabathiran Ramakrishnan"
        "autores" => array:6 [
          0 => array:3 [
            "nombre" => "Ilibagiza"
            "apellidos" => "Regine"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          1 => array:3 [
            "nombre" => "Rehman Syed Rasheed Akram"
            "apellidos" => "Husain"
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">1</span>"
                "identificador" => "fn0005"
              ]
            ]
          ]
          2 => array:3 [
            "nombre" => "Rajagopalan P&#46;"
            "apellidos" => "Aswathi"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
            ]
          ]
          3 => array:3 [
            "nombre" => "D&#46; Ramacharan"
            "apellidos" => "Reddy"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">b</span>"
                "identificador" => "aff0010"
              ]
            ]
          ]
          4 => array:3 [
            "nombre" => "Shiek S&#46;S&#46;J&#46;"
            "apellidos" => "Ahmed"
            "referencia" => array:1 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">c</span>"
                "identificador" => "aff0015"
              ]
            ]
          ]
          5 => array:4 [
            "nombre" => "Veerabathiran"
            "apellidos" => "Ramakrishnan"
            "email" => array:1 [
              0 => "rkgenes@gmail.com"
            ]
            "referencia" => array:2 [
              0 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">a</span>"
                "identificador" => "aff0005"
              ]
              1 => array:2 [
                "etiqueta" => "<span class="elsevierStyleSup">&#42;</span>"
                "identificador" => "cor0005"
              ]
            ]
          ]
        ]
        "afiliaciones" => array:3 [
          0 => array:3 [
            "entidad" => "Genetics Lab&#44; Faculty of Allied Health Sciences&#44; Chettinad Academy of Research and Education&#44; Kelambakkam&#44; Tamil Nadu&#44; India"
            "etiqueta" => "a"
            "identificador" => "aff0005"
          ]
          1 => array:3 [
            "entidad" => "Department of General Medicine&#44; Chettinad Hospital and Research Institute&#44; Chettinad Health City&#44; Kelambakkam&#44; Tamil Nadu&#44; India"
            "etiqueta" => "b"
            "identificador" => "aff0010"
          ]
          2 => array:3 [
            "entidad" => "Drug Discovery Lab&#44; Faculty of Allied Health Sciences&#44; Chettinad Academy of Research and Education&#44; Kelambakkam&#44; Tamil Nadu&#44; India"
            "etiqueta" => "c"
            "identificador" => "aff0015"
          ]
        ]
        "correspondencia" => array:1 [
          0 => array:3 [
            "identificador" => "cor0005"
            "etiqueta" => "&#8270;"
            "correspondencia" => "<span class="elsevierStyleItalic">Corresponding author</span>&#46;"
          ]
        ]
      ]
    ]
    "titulosAlternativos" => array:1 [
      "es" => array:1 [
        "titulo" => "Asociaci&#243;n entre el polimorfismo <span class="elsevierStyleItalic">rs1801282</span> de PPAR&#947; con nefropat&#237;a diab&#233;tica y sensibilidad a la diabetes mellitus de tipo 2 en el sur de India y un metaan&#225;lisis"
      ]
    ]
    "resumenGrafico" => array:2 [
      "original" => 0
      "multimedia" => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 3085
            "Ancho" => 3167
            "Tamanyo" => 733734
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Circos plot illustrating the chromosomal interactions among the current SNP &#40;<span class="elsevierStyleItalic">rs1801282</span>&#41; and its associated SNPs&#46; The Circos plot &#40;outer to inner&#41; denotes chromatin states&#44; annotated genes&#44; histone modifications&#44; transcription factors&#44; rs1801282 variant with associated SNPs &#40;r2&#41;&#46;</p>"
        ]
      ]
    ]
    "textoCompleto" => "<span class="elsevierStyleSections"><span id="sec0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0075">Introduction</span><p id="par0005" class="elsevierStylePara elsevierViewall">Diabetes Mellitus &#40;T2DM&#41; is a complex metabolic disorder characterized by abnormal lipid&#44; protein metabolism&#44; and hyperglycemia&#46; T2DM is considered as serious health problem globally and ranks as the world&#39;s sixth-leading factor causing death&#46;<a class="elsevierStyleCrossRef" href="#bib0190"><span class="elsevierStyleSup">1</span></a> Diabetic Nephropathy is one of the major complication of T2DM and the primary cause of the end-stage renal disease &#40;ESRD&#41;&#44; with a high morbidity rate from 25 to 40&#37; globally&#46;<a class="elsevierStyleCrossRef" href="#bib0195"><span class="elsevierStyleSup">2</span></a> Abnormal glycaemic control and diabetes duration are considered as the major risk factors for DN&#46; The pathogenesis and advancement of T2DM to DN is not well established&#44; previous epidemiological and clinical studies have demonstrated the role of hyperlipidemia in the glomerular injury through the initiation and activation of multiple signaling pathways&#46;<a class="elsevierStyleCrossRef" href="#bib0200"><span class="elsevierStyleSup">3</span></a> A meta-analysis was performed in the year 2011 to evaluate the genetic associations with DN from various ethnic populations which revealed 21 significantly associated genes such as APOC1&#44; ACE&#44; AKR1B1&#44; APOE&#44; CHN2&#44; EPO&#44; &#8216;GREM1&#44; NOS3&#44; HSPG2&#44; FRMD3&#44; CPVL&#44; VEGFA&#44; CARS&#44; and UNC13B&#46;<a class="elsevierStyleCrossRef" href="#bib0205"><span class="elsevierStyleSup">4</span></a> In addition&#44; several Genome-Wide Association studies have documented 56 genetic loci associated with T2DM susceptibility&#46; Also&#44; few single nucleotide polymorphisms &#40;SNPs&#41; were reported in candidate genes such as FTO&#44; MC4R&#44; PPAR&#947;&#44; and ADIPOQ with T2DM&#46;<a class="elsevierStyleCrossRefs" href="#bib0210"><span class="elsevierStyleSup">5&#44;6</span></a></p><p id="par0010" class="elsevierStylePara elsevierViewall">Peroxisome Proliferator-Activated Receptor-Gamma &#40;PPAR&#947;&#41; gene belongs to the nuclear hormone receptor subfamily which controls the expression of genes involved in insulin sensitivity&#44; lipogenesis&#44; adipocyte differentiation&#44; inflammation&#44; and metabolic syndrome&#46;<a class="elsevierStyleCrossRef" href="#bib0220"><span class="elsevierStyleSup">7</span></a> PPAR&#947; gene is localized at 3p25&#46;2 spanning 9 exons encodes 505 amino acids&#46; The PPARs mainly comprise nuclear fatty acid receptors&#44; which have a hydrophobic ligand-binding pocket and a zinc finger DNA binding motif &#40;type-II&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0225"><span class="elsevierStyleSup">8</span></a> To date&#44; numerous case&#8211;control studies have been conducted to identify the possible relationship between PPAR&#947; gene polymorphisms with the risk of T2DM and DN in various ethnic populations&#46;<a class="elsevierStyleCrossRef" href="#bib0230"><span class="elsevierStyleSup">9</span></a> The most common variant located in exon-2 of PPAR&#947; rs1801282 &#40;Proline-12-Alanine&#41;&#44; leading to the substitution of cytosine to guanosine at 34th nucleotide position&#46; This substitution leads to a change in the structure of PPARG protein&#44; which in turn decreases the binding effect of target genes and thereby reducing transcriptional activity&#46;<a class="elsevierStyleCrossRef" href="#bib0235"><span class="elsevierStyleSup">10</span></a> In addition&#44; studies have indicated that rs1801282 polymorphism is found involved in reducing the albuminuria risk and insulin resistance among DM patients&#46;<a class="elsevierStyleCrossRef" href="#bib0240"><span class="elsevierStyleSup">11</span></a> Among worldwide population&#44; Indians belong to the Asian ethnic background&#44; considered as a high-risk population for T2DM&#46; It has been well documented that Asian Indians have a high waist-hip ratio&#44; greater insulin resistance&#44; increased susceptibility to diabetes and posses the risk of coronary heart disease &#40;CHD&#41; compared with Europeans or the Caucasoids&#46;<a class="elsevierStyleCrossRef" href="#bib0245"><span class="elsevierStyleSup">12</span></a> We conducted a case&#8211;control study among the south Indian population belong to Asian ethnic background to determine the rs1801282 association in DN&#44; T2DM&#44; compared to healthy controls&#44; Further&#44; the resulting genotypic frequencies of rs1801282 polymorphism were analyzed with the previously published literature based on the Preferred Reporting Items for Systematic Reviews and Meta-analysis &#40;PRISMA&#41; criteria to confirm its significance across various populations&#46;</p></span><span id="sec0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0080">Methods</span><span id="sec0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0085">Sample characteristics</span><p id="par0015" class="elsevierStylePara elsevierViewall">The samples &#40;diabetic nephropathy&#44; type-2 diabetes mellitus&#44; and healthy controls&#41; for this study were recruited from the subjects attending Department of General Medicine&#44; Chettinad Hospital and Research Institute &#40;CHRI&#41;&#44; Tamil Nadu&#44; India&#44; from January to June 2016&#46; The selection criteria for DN subjects by clinical examination including the routine biochemical assessment such as excreting urine albuminuria &#40;&#62;300<span class="elsevierStyleHsp" style=""></span>mg&#47;L&#41; and serum creatinine &#40;&#62;1<span class="elsevierStyleHsp" style=""></span>mg&#47;dL&#41; were considered and histopathological investigation&#46; The T2DM subjects were diagnosed based on the criteria defined by the World Health Organization &#40;WHO&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0250"><span class="elsevierStyleSup">13</span></a> The controls were selected by following the similar clinical and biochemical examination as done for DN and T2DM&#46; All study participant were age-matched&#44; belonging to South India&#44; Asian ethnicity&#46; The current study protocols were reviewed and approved by the Institutional Human Ethics Committee &#40;03&#47;IHEC&#47;3-16&#41; of the Chettinad Academy of Research and Education&#46; Informed consent was obtained from the participants before the sampling process&#46; Likewise&#44; HIV positive patients&#44; Juvenile diabetic subjects&#44; physically challenged and subjects with cardiac problems were excluded&#46; The demographic data and baseline clinical characteristics from each study subject including gender&#44; age&#44; Body Mass Index &#40;BMI&#41;&#44; the onset of disease&#44; symptoms of the disease&#44; family history&#44; diet&#44; and physical activity were recorded at the time sample collection&#46;</p></span><span id="sec0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0090">Genetic analysis of <span class="elsevierStyleItalic">rs1801282</span> polymorphism</span><p id="par0020" class="elsevierStylePara elsevierViewall">Venous blood &#40;3<span class="elsevierStyleHsp" style=""></span>ml&#41; was collected in EDTA coated tube &#40;BD&#44; USA&#41; from the participants to isolate Genomic DNA using the phenol-chloroform method with minor modifications&#46;<a class="elsevierStyleCrossRef" href="#bib0255"><span class="elsevierStyleSup">14</span></a> The genetic analysis of rs1801282 was performed by Amplification Refractory Mutation System-Polymerase Chain Reaction &#40;ARMS-PCR&#41; using allele-specific primers &#40;<a class="elsevierStyleCrossRef" href="#tbl0005">Table 1</a>&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0260"><span class="elsevierStyleSup">15</span></a> For each PCR reaction&#44; a 10<span class="elsevierStyleHsp" style=""></span>&#956;L reaction mix was setup containing 25<span class="elsevierStyleHsp" style=""></span>ng DNA&#44; 1<span class="elsevierStyleHsp" style=""></span>U TAQ Brazilian Origin&#44; 0&#46;3<span class="elsevierStyleHsp" style=""></span>mmol of each dNTP&#44; 12<span class="elsevierStyleHsp" style=""></span>pmol&#47;&#956;L of each primer&#46; The ARMS-PCR program was performed using an ABI Veriti&#174; Thermal Cycler &#40;California&#44; USA&#41;&#46; The reaction condition for ARMS-PCR was set as initial denaturation &#40;94<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 5<span class="elsevierStyleHsp" style=""></span>min&#41;&#44; denaturation &#40;94<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 45<span class="elsevierStyleHsp" style=""></span>s&#41;&#44; annealing &#40;68<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 45<span class="elsevierStyleHsp" style=""></span>s&#41;&#44; elongation &#40;72<span class="elsevierStyleHsp" style=""></span>&#176;C&#44; 45<span class="elsevierStyleHsp" style=""></span>s&#41; and final elongation at 72<span class="elsevierStyleHsp" style=""></span>&#176;C for 5<span class="elsevierStyleHsp" style=""></span>min&#46; The amplicons were visualized on 1&#46;6&#37; agarose gel together with 100<span class="elsevierStyleHsp" style=""></span>bp DNA Ladder &#40;Dye Plus&#44; Cat no&#58; 3422A&#44; Takara Bio&#41;&#46; Finally&#44; the identified genotypes were further confirmed in the randomly selected subset of overall samples &#40;DN<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>12&#59; T2DM <span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>10&#59; controls<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>08&#41; using Sanger based sequencing &#40;Applied Biosystems 3130&#44; USA&#41;&#46; Additionally&#44; to determine the chromosomal interactions among the SNP variants&#44; we used 3DSNP &#40;<a href="http://www.cbportal.org/3dsnp/index.html">http&#58;&#47;&#47;www&#46;cbportal&#46;org&#47;3dsnp&#47;index&#46;html</a>&#41; software package to generate Circos &#40;circular&#41; plots based on <span class="elsevierStyleItalic">r</span><span class="elsevierStyleSup">2</span> values for visualizing the genomic data&#46;</p><elsevierMultimedia ident="tbl0005"></elsevierMultimedia></span><span id="sec0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0095">Statistical analyses</span><p id="par0025" class="elsevierStylePara elsevierViewall">The statistical analysis for case&#8211;control study was executed by SPSS V&#46;21 &#40;IBM-Analytics&#44; USA&#41; software&#46; The allelic and genotypic frequencies of rs1801282 polymorphism in DN&#44; T2DM and healthy controls were calculated using the Pearson Chi-square test&#46; To determine the distribution of SNP in controls&#44; Hardy-Weinberg Equilibrium &#40;HWE value<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; was used&#46; Additionally&#44; their association of polymorphism was analyzed by determining the odds ratio &#40;OR&#41;&#44; confidence intervals &#40;95&#37; CIs&#41; in dominant &#40;Jj<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>jj vs&#46; Jj&#41; &#40;J-major&#44; j-minor allele&#41; and recessive &#40;jj vs&#46; JJ<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Jj&#41; genetic models&#46;</p></span><span id="sec0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0100">Literature search strategy for Meta-analysis</span><p id="par0030" class="elsevierStylePara elsevierViewall">An extensive literature to select the studies published between January 1991 to December 2017&#44; that discuss the association between rs1801282 polymorphism with DN and T2DM from the database of MEDLINE&#44; PubMed&#44; Cochrane Library&#44; EMBASE&#44; and Google Scholar&#46; The multiple key terms such as &#8220;Diabetic Nephropathy&#8221; &#8220;Type 2 Diabetes Mellitus&#8221;&#44; &#8220;DN&#8221;&#44; &#8220;T2DM&#8221;&#44; &#8220;Peroxisome proliferator-activated receptor gamma gene&#8221;&#44; &#8220;PPAR&#947; gene&#8221;&#44; &#8220;Polymorphism&#8221;&#44; &#8220;rs1801282&#8221; were used to retrieve the relevant articles published in English Language for the meta-analysis with Diabetic Nephropathy vs&#46; Type 2 Diabetes Mellitus&#46; Similarly&#44; multiple keywords such as &#8220;Type 2 Diabetes Mellitus&#8221;&#44; &#8220;T2DM&#8221;&#44; &#8220;Peroxisome proliferator-activated receptor gamma gene&#8221;&#44; &#8220;PPAR&#947; gene&#8221;&#44; &#8220;Genetic association studies&#8221;&#44; &#8220;SNP&#8221;&#44; &#8220;rs1801282&#8221; were used to perform the similar meta-analysis between T2DM vs&#46; controls&#46;</p></span><span id="sec0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0105">Data extraction for meta-analysis</span><p id="par0035" class="elsevierStylePara elsevierViewall">Studies included in this meta-analysis &#40;Diabetic Nephropathy vs&#46; Type 2 Diabetes Mellitus&#59; Type 2 Diabetes Mellitus vs&#46; controls&#41; were essential to meet the following criteria&#39;s&#58; first&#44; the association of PPAR&#947; gene and rs1801282 polymorphism with DN and T2DM&#44; T2DM and controls should be assessed&#46; Second&#44; study should be cases&#8211;controls &#40;two groups&#41;&#46; Third&#44; the articles should provide adequate data to calculate allele and genotype frequencies for the meta-analysis&#46; The information from the collected articles was extracted by two authors &#91;AH and PA&#93;&#44; any discrepancy between the authors was resolved by a group discussion &#40;IR&#44; SSJ&#44; and RK&#41;&#46; The study characteristics such as first author name&#44; year of publication&#44; country&#44; ethnicity&#44; the source of DNA&#44; the sample size for cases-controls&#44; genotypic frequency and genotyping method were extracted&#46;</p></span><span id="sec0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0110">Quality assessment and meta-analysis for <span class="elsevierStyleItalic">rs1801282</span> polymorphism</span><p id="par0040" class="elsevierStylePara elsevierViewall">The methodological quality assessment of each study was evaluated by two independent variables such as the Hardy-Weinberg Equilibrium &#40;HWE&#41;<a class="elsevierStyleCrossRef" href="#bib0265"><span class="elsevierStyleSup">16</span></a> and the Newcastle Ottawa Scale &#40;NOS&#41;&#46;<a class="elsevierStyleCrossRef" href="#bib0270"><span class="elsevierStyleSup">17</span></a> The genotype distribution of included studies among the controls should follow HWE <span class="elsevierStyleItalic">p</span>-value above 0&#46;05&#46; The NOS grading system relies on three main factors such as selection&#44; comparability&#44; and exposure&#46; The studies score up to a maximum of nine points&#44; six or above were considered in this meta-analysis&#46; In the meta-analysis&#44; rs1801282 SNP with risk of DN vs&#46; T2DM and T2DM vs&#46; controls&#44; were performed to calculate the pooled odds ratios &#40;OR&#41; and 95&#37; confidence interval &#40;CI&#41; with &#40;<span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; under allelic &#40;j vs&#46; J&#41; &#40;J-major&#44; j-minor allele&#41;&#44; homozygote &#40;jj vs&#46; JJ&#41;&#44; heterozygote &#40;Jj vs&#46; JJ&#41;&#44; dominant &#40;Jj<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>jj vs&#46; JJ&#41; and recessive &#40;jj vs&#46; JJ<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Jj&#41; genetic models&#46; The heterogeneity between the included studies in this meta-analysis was assessed by the <span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span> test<a class="elsevierStyleCrossRef" href="#bib0275"><span class="elsevierStyleSup">18</span></a> and <span class="elsevierStyleItalic">Q</span>-statistics&#46; Based on the results obtained from heterogeneity &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>50&#41;&#44; fixed effect &#40;Mantel-Haenszel&#39;s&#41;<a class="elsevierStyleCrossRef" href="#bib0280"><span class="elsevierStyleSup">19</span></a> method was used&#44; if not&#44; the random-effect method &#40;DerSimonian and Laird&#39;s&#41; was applied&#46; The publication bias for meta-analysis was assessed by Begg&#39;s funnel plot and Egger&#39;s test&#46;<a class="elsevierStyleCrossRef" href="#bib0285"><span class="elsevierStyleSup">20</span></a> Leave-one-out method was executed to validate the consistency of our results&#46;<a class="elsevierStyleCrossRef" href="#bib0290"><span class="elsevierStyleSup">21</span></a> The meta-analysis was performed using Revman V&#46;5&#46;0 &#40;Cochrane Collaboration&#44; UK&#41; and STATA V&#46;12&#46;0 &#40;Stata Corp&#44; USA&#41;&#46;</p></span></span><span id="sec0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0115">Results</span><span id="sec0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0120">Characteristics of study subjects in case&#8211;control study</span><p id="par0045" class="elsevierStylePara elsevierViewall">The baseline clinical characteristics of the study participants &#40;DN<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>128&#59; T2DM<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148 and controls<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&#41; were illustrated in <a class="elsevierStyleCrossRef" href="#tbl0010">Table 2</a>&#46; Among the samples enrolled in the study&#44; their average<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD of age in DN&#44; T2DM&#44; and control groups were 56&#46;26<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;9&#44; 54&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>6&#46;37 and 54&#46;15<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>7&#46;50 years respectively&#46; Similarly&#44; the body mass index &#40;BMI&#41; were &#40;21&#46;09<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>3&#46;3&#41;&#44; &#40;26&#46;23<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>3&#46;68&#41; and &#40;23&#46;08<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>2&#46;37&#41; for DN&#44; T2DM and control&#46;</p><elsevierMultimedia ident="tbl0010"></elsevierMultimedia></span><span id="sec0055" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0125">Frequencies <span class="elsevierStyleItalic">rs1801282</span> polymorphism between DN vs&#46; T2DM</span><p id="par0050" class="elsevierStylePara elsevierViewall">The genotyping of PPAR&#947; gene polymorphism &#40;rs1801282&#41; was performed using ARMS-PCR and Sanger dideoxy sequencing &#40;<a class="elsevierStyleCrossRef" href="#fig0005">Fig&#46; 1</a>&#41;&#46; The genotype frequency distributions in controls &#40;T2DM&#41; were in concurrence with Hardy&#8211;Weinberg Equilibrium &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46; The allele and genotype frequencies of rs1801282 polymorphisms were assessed to determine the odds ratio &#40;OR&#41;&#44; confidence intervals &#40;95&#37;CIs&#41;&#44; <span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span> and <span class="elsevierStyleItalic">p</span>-value &#40;<a class="elsevierStyleCrossRef" href="#tbl0015">Table 3</a>&#41;&#46; The genotype distribution of rs1801282 polymorphism was 73&#46;43&#37; for JJ&#44; 17&#46;18&#37; for Jj&#44; 09&#46;37&#37; for jj in DN cases and 67&#46;56&#37;&#44; 27&#46;02&#37;&#44; 5&#46;40&#37; in T2DM&#44; respectively&#46; The analysis of rs1801282 polymorphism illustrated a positive association with DN compared with T2DM &#40;<span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#8804;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; in south India&#46; In heterozygous &#40;Jj&#41; and homozygous recessive genotype &#40;jj&#41; model of rs1801282 showed significant risk association in DN patients compared with T2DM with OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;19 &#40;95&#37;CI &#91;0&#46;75&#8211;1&#46;98&#93;&#41; <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;049&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>2&#46;72 &#40;95&#37;CI &#91;0&#46;96&#8211;7&#46;67&#93;&#41; <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;047&#44; respectively&#46; Further&#44; the analysis of dominant and recessive genetic models showed an insignificant difference between DN and T2DM for rs1801282 polymorphism&#46;</p><elsevierMultimedia ident="fig0005"></elsevierMultimedia><elsevierMultimedia ident="tbl0015"></elsevierMultimedia></span><span id="sec0060" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0130">Frequencies of <span class="elsevierStyleItalic">rs1801282</span> polymorphism with T2DM vs&#46; controls</span><p id="par0055" class="elsevierStylePara elsevierViewall">The susceptibility analysis of rs1801282 polymorphism with T2DM and controls was performed&#46; The genotypic frequency distribution in healthy controls was in agreement with HWE &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46; The allele and genotype frequencies of rs1801282 polymorphisms were used to estimate the odds ratio &#40;OR&#41;&#44; confidence intervals &#40;95&#37; CIs&#41;&#44; <span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span> and <span class="elsevierStyleItalic">p</span>-value &#40;<a class="elsevierStyleCrossRef" href="#tbl0020">Table 4</a>&#41;&#46; The genotypic distribution of rs1801282 polymorphism was 67&#46;56&#37; for JJ&#44; 27&#46;02&#37; for Jj&#44; 05&#46;40&#37; for jj in T2DM and 81&#46;08&#37;&#44; 16&#46;21&#37;&#44; 02&#46;70&#37; in controls&#44; respectively&#46; The analysis of rs1801282 polymorphism showed a positive association with T2DM compared with controls &#40;<span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#8804;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46; The minor &#8216;G&#8217; allele showed a positive association among T2DM and controls with OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;92 &#40;95&#37;CI &#91;1&#46;20&#8211;3&#46;07&#93;&#41; <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;003&#46; In heterozygous &#40;Jj&#41; genotype of rs1801282 showed significant risk association among T2DM and controls with OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>2&#46;00 &#40;95&#37;CI &#91;1&#46;12&#8211;3&#46;54&#93;&#41; <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;011&#44; respectively&#46; Likewise&#44; the analysis of dominant genetic model showed significant association among T2DM and controls with OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;48 &#40;95&#37;CI &#91;0&#46;28&#8211;3&#46;83&#93;&#41; <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;005 for rs1801282 polymorphism&#46;</p><elsevierMultimedia ident="tbl0020"></elsevierMultimedia></span><span id="sec0065" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0135">Frequencies of <span class="elsevierStyleItalic">rs1801282</span> polymorphism between DN and controls</span><p id="par0060" class="elsevierStylePara elsevierViewall">The susceptibility analysis of rs1801282 variant with DN and controls was performed &#40;<a class="elsevierStyleCrossRef" href="#tbl0025">Table 5</a>&#41;&#46; The genotype frequency distributions in controls were in agreement with HWE &#40;<span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#46; The genotype distribution of rs1801282 polymorphism was 73&#46;43&#37; for JJ&#44; 17&#46;18&#37; for Jj&#44; 09&#46;37&#37; for jj in DN cases and 81&#46;08&#37;&#44; 16&#46;21&#37;&#44; 02&#46;70&#37; in control&#44; respectively&#46; The minor &#8216;G&#8217; allele showed a positive association among T2DM and control with OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;80 &#40;95&#37;CI &#91;1&#46;13&#8211;2&#46;93&#93;&#41; <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;011&#46; However&#44; the analysis of rs1801282 polymorphism showed a negative association between DN and control with <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#8805;<span class="elsevierStyleHsp" style=""></span>0&#46;05 in the heterozygote&#44; homozygous recessive&#44; dominant and recessive genetic models&#44; respectively&#46; The nucleotide sequences of PPAR&#947; genotypes were deposited &#40;Accession numbers&#58; KY547832&#44; KY547833&#44; KY547834&#44; KY547835&#44; and KY547836&#41; in the NCBI Genbank &#91;<a href="https://www.ncbi.nlm.nih.gov/genbank/">https&#58;&#47;&#47;www&#46;ncbi&#46;nlm&#46;nih&#46;gov&#47;genbank&#47;</a>&#93; database&#46; The Circos plot &#40;outer circle to inner&#41; illustrates the chromatin states&#44; annotated genes&#44; histone modifications&#44; transcription factors&#44; currently studied variant &#40;rs1801282&#41; with related SNPs &#40;<span class="elsevierStyleItalic">r</span><span class="elsevierStyleSup">2</span>&#41; and 3D chromatin interactions &#40;<a class="elsevierStyleCrossRef" href="#fig0010">Fig&#46; 2</a>&#41;&#46;</p><elsevierMultimedia ident="tbl0025"></elsevierMultimedia><elsevierMultimedia ident="fig0010"></elsevierMultimedia></span><span id="sec0070" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0140">Studies characteristics of <span class="elsevierStyleItalic">rs1801282</span> polymorphism with DN vs&#46; TD2<span class="elsevierStyleHsp" style=""></span>M for meta-analysis</span><p id="par0065" class="elsevierStylePara elsevierViewall">In meta-analysis&#44; a total of 678 papers published before December 2017 was retrieved from the initial search in literature databases&#46; The editorials&#44; review articles&#44; duplicates&#44; and case reports were removed after a screening of the abstracts&#46; Further&#44; the studies were assessed for quality control methods such as Hardy-Weinberg Equilibrium and Newcastle Ottawa Scale&#46; Thus&#44; four studies<a class="elsevierStyleCrossRefs" href="#bib0295"><span class="elsevierStyleSup">22&#8211;25</span></a> were added to the meta-analysis of rs1801282 polymorphism and the characteristics of included studies in this meta-analysis were explained in supplementary Table 1&#46; The genotypic&#44; allelic frequencies and HWE&#47;Chi-square values for the included studies were presented in <a class="elsevierStyleCrossRef" href="#tbl0030">Table 6</a>&#46;</p><elsevierMultimedia ident="tbl0030"></elsevierMultimedia></span><span id="sec0075" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0145">Studies characteristics of <span class="elsevierStyleItalic">rs1801282</span> polymorphism with T2DM vs&#46; control for meta-analysis</span><p id="par0070" class="elsevierStylePara elsevierViewall">The literature search published from 1991 up to December 2017 retrieved 846 relevant studies from several electronic databases&#46; After removing the duplicate studies&#44; case reports&#44; studies on cell lines&#44; 236 records remained&#46; According to the quality assessment criteria&#44; followed by HWE analysis&#44; nine studies T2DM<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>6365&#44; controls <span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>5322 participants<a class="elsevierStyleCrossRefs" href="#bib0315"><span class="elsevierStyleSup">26&#8211;33</span></a> were eligible for this meta-analysis&#46; The characteristics &#40;author name&#44; year of publication&#44; country&#44; ethnicity&#44; DNA source&#44; a sample size of cases-controls and genotyping methods&#41; of each study included in the meta-analysis were defined in supplementary Table 2&#46; The genotype&#44; allele frequencies&#44; and HWE&#47;Chi-square values for the studies included in this meta-analysis were presented in <a class="elsevierStyleCrossRef" href="#tbl0035">Table 7</a>&#46;</p><elsevierMultimedia ident="tbl0035"></elsevierMultimedia></span><span id="sec0080" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0150">Meta-analysis of <span class="elsevierStyleItalic">rs1801282</span> polymorphism with DN vs&#46; TD2<span class="elsevierStyleHsp" style=""></span>M susceptibility</span><p id="par0075" class="elsevierStylePara elsevierViewall">The analysis of rs1801282 polymorphism among DN and T2DM revealed no heterogeneity in allelic &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>22&#37;&#41; and dominant &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>18&#37;&#41;&#46; Whereas&#44; moderate heterogeneity was noticed in homozygote &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>49&#37;&#41;&#44; heterozygote &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>52&#37;&#41; and recessive &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>44&#37;&#41; genetic models&#46; Based on values of heterogeneity &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span>&#41; the fixed effects &#40;Mantel&#8211;Haenszel&#39;s&#41; model was implemented&#44; which showed insignificant association with DN risk in allelic &#40;j vs J&#41; with &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;27&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;89&#44; &#40;95&#37;CI &#91;0&#46;71&#8211;1&#46;10&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;26&#44; homozygote &#40;jj vs JJ&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;12&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;87&#44; &#40;95&#37; CI &#91;0&#46;66&#8211;1&#46;12&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;27&#44; dominant &#40;Jj<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>jj vs JJ&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;30&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;86&#44; &#40;95&#37; CI &#91;0&#46;66&#8211;1&#46;12&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;27 and recessive &#40;jj vs JJ<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>Jj&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;15&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;88&#44; &#40;95&#37; CI &#91;0&#46;54&#8211;1&#46;44&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;61 genetic models&#44; respectively&#46; Whereas&#44; the random effects model was used which showed insignificant association with DN risk in the heterozygote &#40;Jj vs JJ&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;10&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;03&#44; &#40;95&#37; CI &#91;0&#46;44&#8211;2&#46;41&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;94&#46; The results of the meta-analysis were shown as forest plots &#40;<a class="elsevierStyleCrossRef" href="#fig0015">Fig&#46; 3</a>&#41;&#46; Further&#44; funnel plot &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>&#41; and Egger&#39;s test was executed which revealed no publication bias in the studied genetic models&#46; Since a low number of studies were from Caucasian and Asian ethnicity&#44; sub-group meta-analysis was not performed&#46;</p><elsevierMultimedia ident="fig0015"></elsevierMultimedia><elsevierMultimedia ident="fig0025"></elsevierMultimedia></span><span id="sec0085" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0155">Meta-analysis of <span class="elsevierStyleItalic">rs1801282</span> polymorphism with T2DM vs&#46; controls</span><p id="par0080" class="elsevierStylePara elsevierViewall">The analysis of rs1801282 polymorphism various T2DM vs&#46; controls revealed moderate heterogeneity in the heterozygote &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>31&#37;&#41; and high heterogeneity was noticed in allelic &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>90&#37;&#41;&#44; homozygote &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>51&#37;&#41;&#44; dominant &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>88&#37;&#41; and recessive &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>45&#37;&#41; genetic models&#46; Based on values of heterogeneity &#40;<span class="elsevierStyleItalic">I</span><span class="elsevierStyleSup">2</span>&#41;&#44; the random-effect method &#40;DerSimonian and Laird&#39;s&#41; was adopted which showed insignificant association with T2DM risk in allelic &#40;j vs J&#41; with &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;00001&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;91&#44; &#40;95&#37;CI &#91;0&#46;64&#8211;1&#46;30&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;61&#44; homozygote &#40;jj vs JJ&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;22&#44; &#40;95&#37; CI &#91;0&#46;62&#8211;2&#46;41&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;57&#44; dominant &#40;Jj &#43;jj vs JJ&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;00001&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;91&#44; &#40;95&#37; CI &#91;0&#46;64&#8211;1&#46;31&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;62 and recessive &#40;jj vs JJ&#43; Jj&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;08&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;23&#44; &#40;95&#37; CI &#91;0&#46;65&#8211;2&#46;30&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;52 genetic models respectively&#46; The fixed effects &#40;Mantel-Haenszel&#39;s&#41; model was used&#44; which showed significant association with DN risk in heterozygote &#40;Jj vs JJ&#41; &#40;<span class="elsevierStyleItalic">Q</span> test <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;18&#41;&#44; OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;56&#44; &#40;95&#37; CI &#91;0&#46;43&#8211;0&#46;74&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#8804;<span class="elsevierStyleHsp" style=""></span>0&#46;0001&#46; The results of meta-analysis were illustrated as forest plot &#40;<a class="elsevierStyleCrossRef" href="#fig0020">Fig&#46; 4</a>&#41;&#46; Further&#44; Begg&#39;s funnel plot &#40;<a class="elsevierStyleCrossRef" href="#fig0025">Fig&#46; 5</a>&#41; and Egger&#39;s regression test were performed which suggested no publication bias in the analyzed genetic models&#46; Since a low number of studies were from Caucasian ethnicity&#44; sub-group analysis was not performed&#46;</p><elsevierMultimedia ident="fig0020"></elsevierMultimedia></span></span><span id="sec0090" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0160">Discussion</span><p id="par0085" class="elsevierStylePara elsevierViewall">T2DM is a complex metabolic disorder where environmental&#44; genetic factors and lifestyle contributing to disease pathogenesis&#46;<a class="elsevierStyleCrossRef" href="#bib0355"><span class="elsevierStyleSup">34</span></a> The DN susceptibility has been related to various genes localized at different chromosomes&#46; Of various genes&#44; the PPAR&#947; nuclear receptor expressed in adipose tissue and renal glomeruli play a major role in the developmental process of DN&#46;<a class="elsevierStyleCrossRef" href="#bib0360"><span class="elsevierStyleSup">35</span></a> The rs1801282 polymorphism has been found to be linked with the reduced ability of trans-activate responsive promoters and thereby lowering the PPAR-&#947; transcriptional activity&#46;<a class="elsevierStyleCrossRef" href="#bib0365"><span class="elsevierStyleSup">36</span></a> On the other hand&#44; PPARs is a potential target for the Glitazones or Thiazolidinediones &#40;TZDs&#41; for the management of T2DM&#46;<a class="elsevierStyleCrossRef" href="#bib0370"><span class="elsevierStyleSup">37</span></a></p><p id="par0090" class="elsevierStylePara elsevierViewall">In this study&#44; we have validated the association between PPAR&#947; &#40;rs1801282&#41; polymorphism with the risk of developing DN&#44; T2DM in the south Indian population by comparing 1&#41; DN vs&#46; T2DM&#44; 2&#41; DN vs&#46; controls and 3&#41; T2DM vs&#46; controls&#46; The analysis revealed a positive association with <span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05 between DN and T2DM subjects suggesting that rs1801282 polymorphism might be a risk factor for DN in our study population&#46; These results deviate from a previously published study from the DN subjects of Turkey&#46;<a class="elsevierStyleCrossRef" href="#bib0300"><span class="elsevierStyleSup">23</span></a> The analysis of rs1801282 polymorphism among T2DM and controls showed significant association &#40;<span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#8804;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; in derived&#8217;G&#8217; allele and heterozygous genotype&#46; These results were in accordance with a previously published study on Japanese subjects belonging to East Asian ethnicity&#46;<a class="elsevierStyleCrossRef" href="#bib0330"><span class="elsevierStyleSup">29</span></a></p><p id="par0095" class="elsevierStylePara elsevierViewall">In addition&#44; we have performed a meta-analysis for rs1801282 polymorphism to investigate the effect of the PPAR&#947; gene on susceptibility with DN and T2DM in mixed population&#46; For&#44; which the articles related on DN and T2DM were retrieved from several electronic databases based on PRISMA guidelines and NOS scaling was used for quality assessment&#46; The results of our meta-analysis showed insignificant association with DN in the allelic OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;89&#44; &#40;95&#37;CI &#91;0&#46;71&#8211;1&#46;10&#93;&#41;&#44; homozygote OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;87&#44; &#40;95&#37; CI &#91;0&#46;66&#8211;1&#46;12&#93;&#41;&#44; heterozygote OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;03&#44; &#40;95&#37; CI &#91;0&#46;44&#8211;2&#46;41&#93;&#41;&#44; dominant OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;86&#44; &#40;95&#37; CI &#91;0&#46;66&#8211;1&#46;12&#93;&#41;&#44; and recessive OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;88&#44; &#40;95&#37; CI &#91;0&#46;54&#8211;1&#46;44&#93;&#41; genetic models respectively&#46; Similar to the results of this meta-analysis&#44; rs1801282 polymorphism shows an insignificant association in Turkey 23 and Taiwan 25 populations&#46;</p><p id="par0100" class="elsevierStylePara elsevierViewall">The meta-analysis of Type 2 Diabetes Mellitus and controls showed significant association among T2DM and controls in the heterozygote genetic model with OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;56&#44; &#40;95&#37; CI &#91;0&#46;43&#8211;0&#46;74&#93;&#41; and insignificant association allelic OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;91&#44; &#40;95&#37;CI &#91;0&#46;64&#8211;1&#46;30&#93;&#41;&#44; homozygote OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;22&#44; &#40;95&#37;CI &#91;0&#46;62&#8211;2&#46;41&#93;&#41;&#44; dominant OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;91&#44; &#40;95&#37;CI &#91;0&#46;64&#8211;1&#46;31&#93;&#41;&#44; and recessive OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>1&#46;23&#44; &#40;95&#37;CI &#91;0&#46;65&#8211;2&#46;30&#93;&#41; genetic models respectively&#46; The results of meta- were in agreement with Japan 29 and Central India 32 whereas disagreement was noticed with Han Chinese 28 population&#46; Overall&#44; the analysis provides significant knowledge on rs1801282 with DN and T2DM in both south Indian and mixed population&#46; However&#44; the results of our analysis can be considered with certain limitations&#46; First&#44; we studied the association between PPAR&#947; genotypes &#40;rs1801282&#41; among DN&#44; T2DM and their phenotypes were not studied extensively&#46; Second&#44; T2DM is a multi-factorial metabolic disorder&#44; other confounding factors including age&#44; gender&#44; obesity&#44; lifestyle habits&#44; and other environmental factors were not considered in our analysis&#46; Third&#44; the studies included in our meta-analysis were restricted to articles published in the English language&#46; Fourth&#44; the genotyping methods were not the same in the included studies&#46; Fifth&#44; we have studied only one SNP &#40;rs1801282&#41; in the PPAR&#947; gene other polymorphic variants were not considered&#46;</p></span><span id="sec0095" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0165">Conclusion</span><p id="par0105" class="elsevierStylePara elsevierViewall">In conclusion&#44; our case&#8211;control study demonstrates the involvement of PPAR&#947; gene &#40;rs1801282&#41; variant among DN and T2DM in South Indian population&#46; Alternative results were noticed in other population may be due to genetic diversity&#46; However&#44; independent replication studies with larger sample size are required to confirm the associations that we observed in this study&#46; Alternatively&#44; the meta-analysis of DN vs&#46; controls suggests that the PPAR&#947; polymorphism is not a risk factor for developing DN&#46; Whereas&#44; a meta-analysis of T2DM vs&#46; controls suggests that rs1801282 polymorphism result showed a positive association for developing T2DM&#46; Further&#44; well designed&#44; large-scale studies combining with other multiple factors are required to validate the PPAR&#947; gene associated with risk of developing DN and T2DM&#46;</p></span><span id="sec0100" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0170">Funding</span><p id="par0110" class="elsevierStylePara elsevierViewall">The author &#40;RI&#41; thanks the <span class="elsevierStyleGrantSponsor" id="gs1">Chettinad Academy of Research and Education</span> for funding this research&#46;</p></span><span id="sec0105" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0175">Conflicts of interest</span><p id="par0115" class="elsevierStylePara elsevierViewall">The authors declare that they have no conflict of interest&#46;</p></span></span>"
    "textoCompletoSecciones" => array:1 [
      "secciones" => array:13 [
        0 => array:3 [
          "identificador" => "xres1358449"
          "titulo" => "Abstract"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0005"
              "titulo" => "Background"
            ]
            1 => array:2 [
              "identificador" => "abst0010"
              "titulo" => "Objective"
            ]
            2 => array:2 [
              "identificador" => "abst0015"
              "titulo" => "Methods"
            ]
            3 => array:2 [
              "identificador" => "abst0020"
              "titulo" => "Results"
            ]
            4 => array:2 [
              "identificador" => "abst0025"
              "titulo" => "Conclusion"
            ]
          ]
        ]
        1 => array:2 [
          "identificador" => "xpalclavsec1249390"
          "titulo" => "Keywords"
        ]
        2 => array:3 [
          "identificador" => "xres1358448"
          "titulo" => "Resumen"
          "secciones" => array:5 [
            0 => array:2 [
              "identificador" => "abst0030"
              "titulo" => "Antecedentes"
            ]
            1 => array:2 [
              "identificador" => "abst0035"
              "titulo" => "Objetivo"
            ]
            2 => array:2 [
              "identificador" => "abst0040"
              "titulo" => "M&#233;todos"
            ]
            3 => array:2 [
              "identificador" => "abst0045"
              "titulo" => "Resultados"
            ]
            4 => array:2 [
              "identificador" => "abst0050"
              "titulo" => "Conclusi&#243;n"
            ]
          ]
        ]
        3 => array:2 [
          "identificador" => "xpalclavsec1249389"
          "titulo" => "Palabras clave"
        ]
        4 => array:2 [
          "identificador" => "sec0005"
          "titulo" => "Introduction"
        ]
        5 => array:3 [
          "identificador" => "sec0010"
          "titulo" => "Methods"
          "secciones" => array:6 [
            0 => array:2 [
              "identificador" => "sec0015"
              "titulo" => "Sample characteristics"
            ]
            1 => array:2 [
              "identificador" => "sec0020"
              "titulo" => "Genetic analysis of rs1801282 polymorphism"
            ]
            2 => array:2 [
              "identificador" => "sec0025"
              "titulo" => "Statistical analyses"
            ]
            3 => array:2 [
              "identificador" => "sec0030"
              "titulo" => "Literature search strategy for Meta-analysis"
            ]
            4 => array:2 [
              "identificador" => "sec0035"
              "titulo" => "Data extraction for meta-analysis"
            ]
            5 => array:2 [
              "identificador" => "sec0040"
              "titulo" => "Quality assessment and meta-analysis for rs1801282 polymorphism"
            ]
          ]
        ]
        6 => array:3 [
          "identificador" => "sec0045"
          "titulo" => "Results"
          "secciones" => array:8 [
            0 => array:2 [
              "identificador" => "sec0050"
              "titulo" => "Characteristics of study subjects in case&#8211;control study"
            ]
            1 => array:2 [
              "identificador" => "sec0055"
              "titulo" => "Frequencies rs1801282 polymorphism between DN vs&#46; T2DM"
            ]
            2 => array:2 [
              "identificador" => "sec0060"
              "titulo" => "Frequencies of rs1801282 polymorphism with T2DM vs&#46; controls"
            ]
            3 => array:2 [
              "identificador" => "sec0065"
              "titulo" => "Frequencies of rs1801282 polymorphism between DN and controls"
            ]
            4 => array:2 [
              "identificador" => "sec0070"
              "titulo" => "Studies characteristics of rs1801282 polymorphism with DN vs&#46; TD2 M for meta-analysis"
            ]
            5 => array:2 [
              "identificador" => "sec0075"
              "titulo" => "Studies characteristics of rs1801282 polymorphism with T2DM vs&#46; control for meta-analysis"
            ]
            6 => array:2 [
              "identificador" => "sec0080"
              "titulo" => "Meta-analysis of rs1801282 polymorphism with DN vs&#46; TD2 M susceptibility"
            ]
            7 => array:2 [
              "identificador" => "sec0085"
              "titulo" => "Meta-analysis of rs1801282 polymorphism with T2DM vs&#46; controls"
            ]
          ]
        ]
        7 => array:2 [
          "identificador" => "sec0090"
          "titulo" => "Discussion"
        ]
        8 => array:2 [
          "identificador" => "sec0095"
          "titulo" => "Conclusion"
        ]
        9 => array:2 [
          "identificador" => "sec0100"
          "titulo" => "Funding"
        ]
        10 => array:2 [
          "identificador" => "sec0105"
          "titulo" => "Conflicts of interest"
        ]
        11 => array:2 [
          "identificador" => "xack471369"
          "titulo" => "Acknowledgment"
        ]
        12 => array:1 [
          "titulo" => "References"
        ]
      ]
    ]
    "pdfFichero" => "main.pdf"
    "tienePdf" => true
    "fechaRecibido" => "2019-07-29"
    "fechaAceptado" => "2020-01-19"
    "PalabrasClave" => array:2 [
      "en" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Keywords"
          "identificador" => "xpalclavsec1249390"
          "palabras" => array:5 [
            0 => "Diabetic Nephropathy"
            1 => "SNP"
            2 => "PPAR&#947;"
            3 => "ARMS-PCR"
            4 => "Genetic models"
          ]
        ]
      ]
      "es" => array:1 [
        0 => array:4 [
          "clase" => "keyword"
          "titulo" => "Palabras clave"
          "identificador" => "xpalclavsec1249389"
          "palabras" => array:5 [
            0 => "Nefropat&#237;a diab&#233;tica"
            1 => "PNU"
            2 => "PPAR&#947;"
            3 => "RCP-ARMS"
            4 => "Modelos gen&#233;ticos"
          ]
        ]
      ]
    ]
    "tieneResumen" => true
    "resumen" => array:2 [
      "en" => array:3 [
        "titulo" => "Abstract"
        "resumen" => "<span id="abst0005" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0010">Background</span><p id="spar0005" class="elsevierStyleSimplePara elsevierViewall">Diabetic Nephropathy &#40;DN&#41; is a major complication of Type 2 Diabetes Mellitus &#40;T2DM&#41; with high morbidity rates worldwide&#46;</p></span> <span id="abst0010" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0015">Objective</span><p id="spar0010" class="elsevierStyleSimplePara elsevierViewall">To determine the association of PPAR&#947; rs1801282 polymorphism in T2DM and DN in south Indian population&#46;</p></span> <span id="abst0015" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0020">Methods</span><p id="spar0015" class="elsevierStyleSimplePara elsevierViewall">We have conducted a case&#8211;control study to test the association of rs1801282 polymorphism with T2DM and DN in 424 subjects &#40;DN<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>128&#59; T2DM<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148 and controls<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&#41; belonging to the south Indian population using ARMS-PCR and Sanger sequencing method&#46; Further&#44; a meta-analysis was performed for rs1801282 polymorphism from the published literature retrieved from various electronic databases to determine the susceptibility among T2DM and DN across various ethnic populations under five genetic models&#46;</p></span> <span id="abst0020" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0025">Results</span><p id="spar0020" class="elsevierStyleSimplePara elsevierViewall">The genotyping of rs1801282 polymorphism showed significant &#40;<span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; association with DN and T2DM compared to controls&#46; In the meta-analysis&#44; no significant association &#40;<span class="elsevierStyleItalic">p</span>-value<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#46;05&#41; was noticed for rs1801282 with DN vs&#46; controls in homozygote&#44; heterozygote&#44; allelic&#44; recessive and dominant genetic models&#46; However&#44; a significant association was observed between rs1801282 SNP and T2DM under heterozygote &#40;Jj vs JJ&#41; genetic model with OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#46;56&#44; &#40;95&#37;CI &#91;0&#46;43&#8211;0&#46;74&#93;&#41;&#44; <span class="elsevierStyleItalic">p</span><span class="elsevierStyleHsp" style=""></span>&#8804;<span class="elsevierStyleHsp" style=""></span>0&#46;0001 of Asian and Caucasian populations&#46;</p></span> <span id="abst0025" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0030">Conclusion</span><p id="spar0025" class="elsevierStyleSimplePara elsevierViewall">Overall analysis suggests that the rs1801282 polymorphism might be associated with DN and T2DM&#46; More case&#8211;control studies on the PPAR&#947; gene with a larger sample size including all the confounding factors are required to corroborate the findings from this meta-analysis&#46;</p></span>"
        "secciones" => array:5 [
          0 => array:2 [
            "identificador" => "abst0005"
            "titulo" => "Background"
          ]
          1 => array:2 [
            "identificador" => "abst0010"
            "titulo" => "Objective"
          ]
          2 => array:2 [
            "identificador" => "abst0015"
            "titulo" => "Methods"
          ]
          3 => array:2 [
            "identificador" => "abst0020"
            "titulo" => "Results"
          ]
          4 => array:2 [
            "identificador" => "abst0025"
            "titulo" => "Conclusion"
          ]
        ]
      ]
      "es" => array:3 [
        "titulo" => "Resumen"
        "resumen" => "<span id="abst0030" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0040">Antecedentes</span><p id="spar0030" class="elsevierStyleSimplePara elsevierViewall">La nefropat&#237;a diab&#233;tica &#40;ND&#41; es una complicaci&#243;n importante de la diabetes mellitus de tipo 2 &#40;DMT2&#41; con altas tasas de morbilidad mundial&#46;</p></span> <span id="abst0035" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0045">Objetivo</span><p id="spar0035" class="elsevierStyleSimplePara elsevierViewall">Determinar la asociaci&#243;n del polimorfismo <span class="elsevierStyleItalic">rs1801282</span> de PPAR&#947; en la DMT2 y la ND en la poblaci&#243;n del sur de India&#46;</p></span> <span id="abst0040" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0050">M&#233;todos</span><p id="spar0040" class="elsevierStyleSimplePara elsevierViewall">Hemos llevado a cabo un estudio de casos y controles para analizar la asociaci&#243;n del polimorfismo <span class="elsevierStyleItalic">rs1801282</span> con la DMT2 y la ND en 424 sujetos &#40;ND<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>128&#59; DMT2<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148 y controles<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&#41; pertenecientes a la poblaci&#243;n del sur de India mediante RCP-ARMS y m&#233;todo de secuenciaci&#243;n de Sanger&#46; Adem&#225;s&#44; se realiz&#243; un metaan&#225;lisis para el polimorfismo de <span class="elsevierStyleItalic">rs1801282</span> a partir de la literatura publicada en varias bases de datos electr&#243;nicas para determinar la sensibilidad entre la DMT2 y la ND en varias poblaciones &#233;tnicas con 5 modelos gen&#233;ticos&#46;</p></span> <span id="abst0045" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0055">Resultados</span><p id="spar0045" class="elsevierStyleSimplePara elsevierViewall">El genotipado de polimorfismo <span class="elsevierStyleItalic">rs1801282</span> demostr&#243; una asociaci&#243;n significativa &#40;valor de p<span class="elsevierStyleHsp" style=""></span>&#60;<span class="elsevierStyleHsp" style=""></span>0&#44;05&#41; con la ND y la DMT2 en comparaci&#243;n con los controles&#46; En el metaan&#225;lisis no se observ&#243; asociaci&#243;n significativa &#40;valor de p<span class="elsevierStyleHsp" style=""></span>&#62;<span class="elsevierStyleHsp" style=""></span>0&#44;05&#41; de <span class="elsevierStyleItalic">rs1801282</span> con la ND frente a los controles en modelos gen&#233;ticos homocig&#243;ticos&#44; heterocig&#243;ticos&#44; al&#233;licos&#44; recesivos y dominantes&#46; Sin embargo&#44; se observ&#243; una asociaci&#243;n significativa entre el polimorfismo de nucle&#243;tido &#250;nico &#40;PNU&#41; <span class="elsevierStyleItalic">rs1801282</span> SNP y la DMT2 en el modelo gen&#233;tico heterocig&#243;tico &#40;Jj frente a JJ&#41; con OR<span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>0&#44;56&#44; &#40;IC del 95&#37;&#58; 0&#44;43-0&#44;74&#59; p<span class="elsevierStyleHsp" style=""></span>&#8804;<span class="elsevierStyleHsp" style=""></span>0&#44;0001 de poblaciones asi&#225;ticas y cauc&#225;sicas&#46;</p></span> <span id="abst0050" class="elsevierStyleSection elsevierViewall"><span class="elsevierStyleSectionTitle" id="sect0060">Conclusi&#243;n</span><p id="spar0050" class="elsevierStyleSimplePara elsevierViewall">El an&#225;lisis general sugiere que el polimorfismo <span class="elsevierStyleItalic">rs1801282</span> puede asociarse a ND y a DMT2&#46; Se precisan m&#225;s estudios de casos y controles sobre el gen PPAR&#947; con un tama&#241;o de la muestra mayor que incluya todos los factores de confusi&#243;n para corroborar los resultados de este metaan&#225;lisis&#46;</p></span>"
        "secciones" => array:5 [
          0 => array:2 [
            "identificador" => "abst0030"
            "titulo" => "Antecedentes"
          ]
          1 => array:2 [
            "identificador" => "abst0035"
            "titulo" => "Objetivo"
          ]
          2 => array:2 [
            "identificador" => "abst0040"
            "titulo" => "M&#233;todos"
          ]
          3 => array:2 [
            "identificador" => "abst0045"
            "titulo" => "Resultados"
          ]
          4 => array:2 [
            "identificador" => "abst0050"
            "titulo" => "Conclusi&#243;n"
          ]
        ]
      ]
    ]
    "NotaPie" => array:1 [
      0 => array:3 [
        "etiqueta" => "1"
        "nota" => "<p class="elsevierStyleNotepara" id="npar0020">Equally contributed&#46;</p>"
        "identificador" => "fn0005"
      ]
    ]
    "apendice" => array:1 [
      0 => array:1 [
        "seccion" => array:1 [
          0 => array:4 [
            "apendice" => "<p id="par0130" class="elsevierStylePara elsevierViewall">The following are the supplementary data to this article&#58;<elsevierMultimedia ident="upi0005"></elsevierMultimedia></p>"
            "etiqueta" => "Appendix A"
            "titulo" => "Supplementary data"
            "identificador" => "sec0115"
          ]
        ]
      ]
    ]
    "multimedia" => array:13 [
      0 => array:7 [
        "identificador" => "fig0005"
        "etiqueta" => "Fig&#46; 1"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr1.jpeg"
            "Alto" => 1344
            "Ancho" => 3167
            "Tamanyo" => 364741
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0055" class="elsevierStyleSimplePara elsevierViewall">DNA sequence electropherograms of <span class="elsevierStyleItalic">rs1801282</span> polymorphism in the <span class="elsevierStyleItalic">PPAR&#947;</span> gene&#46; Examples of homozygous dominant &#40;JJ genotype&#41; and homozygous recessive &#40;jj genotype&#41; condition of the studied SNP&#46;</p>"
        ]
      ]
      1 => array:7 [
        "identificador" => "fig0010"
        "etiqueta" => "Fig&#46; 2"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr2.jpeg"
            "Alto" => 3085
            "Ancho" => 3167
            "Tamanyo" => 733734
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0060" class="elsevierStyleSimplePara elsevierViewall">Circos plot illustrating the chromosomal interactions among the current SNP &#40;<span class="elsevierStyleItalic">rs1801282</span>&#41; and its associated SNPs&#46; The Circos plot &#40;outer to inner&#41; denotes chromatin states&#44; annotated genes&#44; histone modifications&#44; transcription factors&#44; rs1801282 variant with associated SNPs &#40;r2&#41;&#46;</p>"
        ]
      ]
      2 => array:7 [
        "identificador" => "fig0015"
        "etiqueta" => "Fig&#46; 3"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr3.jpeg"
            "Alto" => 3690
            "Ancho" => 3167
            "Tamanyo" => 1023682
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0065" class="elsevierStyleSimplePara elsevierViewall">Forest plots showing individual and pooled ORs &#40;95&#37; CI&#41; of the risk for <span class="elsevierStyleItalic">rs1801282</span> polymorphism with Diabetic Nephropathy and Type 2 Diabetes Mellitus&#46; The Forest Plots provides an insignificant association between the PPAR&#947; polymorphism with DN and T2DM under five genetic models&#46; The error bars indicate 95&#37; CIs&#46; Squares represent individual studies in the meta-analysis&#46; Diamonds represent the pooled OR&#46;</p>"
        ]
      ]
      3 => array:7 [
        "identificador" => "fig0020"
        "etiqueta" => "Fig&#46; 4"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr4.jpeg"
            "Alto" => 4500
            "Ancho" => 2880
            "Tamanyo" => 1258588
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0070" class="elsevierStyleSimplePara elsevierViewall">Forest plots showing individual and pooled ORs &#40;95&#37; CI&#41; of the risk for <span class="elsevierStyleItalic">rs1801282</span> polymorphism with Type 2 Diabetes Mellitus and controls&#46; The Forest Plots provides an insignificant association between the PPAR&#947; polymorphism with T2DM and controls under five genetic models&#46; The error bars indicate 95&#37; CIs&#46; Solid squares represent individual studies included in the meta-analysis&#46; Solid diamonds represent the pooled OR&#46;</p>"
        ]
      ]
      4 => array:7 [
        "identificador" => "fig0025"
        "etiqueta" => "Fig&#46; 5"
        "tipo" => "MULTIMEDIAFIGURA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "figura" => array:1 [
          0 => array:4 [
            "imagen" => "gr5.jpeg"
            "Alto" => 1213
            "Ancho" => 3167
            "Tamanyo" => 250571
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0075" class="elsevierStyleSimplePara elsevierViewall">Funnel plots of publication biases on the relationship of <span class="elsevierStyleItalic">PPAR&#947;</span> &#40;<span class="elsevierStyleItalic">rs1801282</span>&#41; polymorphism&#46; Funnel plots for publication bias &#40;five genetic models&#41;&#46; Each point indicates the individual study included in this meta-analysis&#46; A&#41; Diabetic Nephropathy and Type 2 Diabetes Mellitus B&#41; Type 2 Diabetes Mellitus and Controls&#46;</p>"
        ]
      ]
      5 => array:8 [
        "identificador" => "tbl0005"
        "etiqueta" => "Table 1"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at1"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0085" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleSup">a</span> IF-inner forward&#44; IR-inner reverse&#44; OF-outer forward&#44; OR- outer reverse&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer-ID<span class="elsevierStyleSup">a</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Primer sequence &#40;5&#8242;-3&#8242;&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Allele&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of base pairs&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Tm &#40;&#176;C&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Total length &#40;Bp&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SNP-1 OF-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">AAACTGATGTCTTGACTCATGGGTGTATT&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">29&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">361&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SNP-1 OR-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GCAACGAGCTAAGCATTAAAATACTGGA&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SNP-1 IF-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GAAACTCTGGGAGATTCTCCTATTGTCC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">C</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">28&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">221&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">SNP-1 IR-&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GTATCAGTGAAGGAATCGCTTTCAGC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleBold">G</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">65&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">194&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2333885.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0080" class="elsevierStyleSimplePara elsevierViewall">Designed primers for <span class="elsevierStyleItalic">PPAR&#947;</span> &#40;<span class="elsevierStyleItalic">rs1801282&#41;</span> genotyping&#46;</p>"
        ]
      ]
      6 => array:8 [
        "identificador" => "tbl0010"
        "etiqueta" => "Table 2"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at2"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0095" class="elsevierStyleSimplePara elsevierViewall">Data are presented as mean<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>SD&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Factors&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Diabetic nephropathy &#40;<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>128&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Type 2 diabetes mellitus&#40;<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span> 148&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;<span class="elsevierStyleItalic">N</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Men&#58;women</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">106&#58;22&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">96&#58;52&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">110&#58;38&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Mean Age &#40;years&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">56&#46;26<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>8&#46;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&#46;75<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>6&#46;37&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&#46;15<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>7&#46;50&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Body mass index &#40;kg&#47;m</span><span class="elsevierStyleSup"><span class="elsevierStyleItalic">2</span></span><span class="elsevierStyleItalic">&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">21&#46;09<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>3&#46;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">26&#46;23<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>3&#46;68&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">23&#46;08<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>2&#46;37&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Duration of diabetes &#40;years&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">11&#46;4<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>5&#46;97&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">6&#46;65<span class="elsevierStyleHsp" style=""></span>&#177;<span class="elsevierStyleHsp" style=""></span>4&#46;61&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nil&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Family history of diabetes &#40;&#37;&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">77&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">33&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Controlling insulin levels</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Oral hypoglycaemic drugs&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">108&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nil&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Insulin&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">74&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Nil&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Food habits</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Vegetarian&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">44&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Non-vegetarian&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">108&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">104&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">118&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="4" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Physical activity &#40;30</span><span class="elsevierStyleHsp" style=""></span><span class="elsevierStyleItalic">min&#47;day&#41;</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">18&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">46&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2333880.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0090" class="elsevierStyleSimplePara elsevierViewall">Demographic and base-line clinical characteristics of DN&#44; T2DMand Controls&#46;</p>"
        ]
      ]
      7 => array:8 [
        "identificador" => "tbl0015"
        "etiqueta" => "Table 3"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at3"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0105" class="elsevierStyleSimplePara elsevierViewall">HWE&#44; Hardy&#8211;Weinberg equilibrium&#44; OR&#44; Odd&#39;s ratio&#59; <span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span>&#44; Chi-square&#59; <span class="elsevierStyleItalic">p</span> value-one tailed test&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Polymorphism&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequencies&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Diabetic nephropathy <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>128&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Type 2 diabetes mellitus <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">95&#37; CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">rs1801282</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Allele</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">210 &#40;82&#46;03&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">240 &#40;81&#46;08&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;431&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">G&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">46 &#40;17&#46;96&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">56 &#40;18&#46;91&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;93&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;60&#8211;1&#46;44&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genotype</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94 &#40;73&#46;43&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100 &#40;67&#46;56&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;147&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;049<a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22 &#40;17&#46;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40 &#40;27&#46;02&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;19&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;75&#8211;1&#46;98&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12 &#40;09&#46;37&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">08 &#40;05&#46;40&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;72&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;96&#8211;7&#46;67&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;74&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;047<a class="elsevierStyleCrossRef" href="#tblfn0005">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="9" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="9" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genetic model</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Dominant&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CG<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>GG vs CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;78&#8211;2&#46;23&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;175&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Recessive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG vs CC<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>CG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;81&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;71&#8211;4&#46;57&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;61&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;150&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2333882.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0005"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0005">Significant <span class="elsevierStyleItalic">p</span>-value&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0100" class="elsevierStyleSimplePara elsevierViewall">Association of the <span class="elsevierStyleItalic">PPAR&#947;</span> Gene polymorphism with DN and T2DM&#46;</p>"
        ]
      ]
      8 => array:8 [
        "identificador" => "tbl0020"
        "etiqueta" => "Table 4"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at4"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0115" class="elsevierStyleSimplePara elsevierViewall">HWE&#44; Hardy&#8211;Weinberg equilibrium&#59; OR&#44; Odd&#39;s ratio&#59; <span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span>&#44; Chi-square&#59; <span class="elsevierStyleItalic">p</span>-value-one tailed test&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Polymorphism&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequencies&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Type 2 diabetes mellitus <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">95&#37; CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">rs1801282</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Allele</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">240 &#40;81&#46;08&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">264 &#40;89&#46;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4&#46;69&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;003<a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">G&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">56 &#40;18&#46;91&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;10&#46;81&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;92&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;20&#8211;3&#46;07&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genotype</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100 &#40;67&#46;56&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">120 &#40;81&#46;08&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;052&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;76&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;011<a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">40 &#40;27&#46;02&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24 &#40;16&#46;21&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;00&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;12&#8211;3&#46;54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">08 &#40;05&#46;40&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">04 &#40;02&#46;70&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;20&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;32&#8211;4&#46;41&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;528&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="9" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="9" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genetic model</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Dominant&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CG<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>GG vs CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;28&#8211;3&#46;83&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">7&#46;08&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;005<a class="elsevierStyleCrossRef" href="#tblfn0010">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Recessive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG vs CC<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>CG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;05&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;60&#8211;6&#46;98&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;39&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;188&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2333883.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0010"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0010">Significant <span class="elsevierStyleItalic">p</span>-value&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0110" class="elsevierStyleSimplePara elsevierViewall">Association of the <span class="elsevierStyleItalic">PPAR&#947;</span> Gene polymorphism with T2DM and controls&#46;</p>"
        ]
      ]
      9 => array:8 [
        "identificador" => "tbl0025"
        "etiqueta" => "Table 5"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at5"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:3 [
          "leyenda" => "<p id="spar0125" class="elsevierStyleSimplePara elsevierViewall">HWE&#44; Hardy&#8211;Weinberg equilibrium&#59; OR&#44; Odd&#39;s ratio&#59; <span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span>&#44; Chi-square&#59; <span class="elsevierStyleItalic">p</span>-value-one tailed test&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Polymorphism&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Frequencies&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Diabetic nephropathy <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>128&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls <span class="elsevierStyleItalic">n</span><span class="elsevierStyleHsp" style=""></span>&#61;<span class="elsevierStyleHsp" style=""></span>148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">OR&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">95&#37; CI&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">&#967;</span><span class="elsevierStyleSup">2</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black"><span class="elsevierStyleItalic">p</span>-Value&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">rs1801282</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Allele</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">C&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">210 &#40;82&#46;03&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">264 &#40;89&#46;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;80&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;011<a class="elsevierStyleCrossRef" href="#tblfn0015">&#42;</a>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">G&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">46 &#40;17&#46;96&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">32 &#40;10&#46;81&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;80&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;13&#8211;2&#46;93&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genotype</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94 &#40;73&#46;43&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">120 &#40;81&#46;08&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;052&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Reference&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;63&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;373&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">22 &#40;17&#46;18&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24 &#40;16&#46;21&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;17&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;61&#8211;2&#46;21&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">12 &#40;09&#46;37&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">04 &#40;02&#46;70&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;27&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;91&#8211;4&#46;61&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;061&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="9" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleVsp" style="height:0.5px"></span></td></tr><tr title="table-row"><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " colspan="9" align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleItalic">Genetic model</span></td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Dominant&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">CG<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>GG vs CC&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;36&#8211;1&#46;13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;30&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;085&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t"><span class="elsevierStyleHsp" style=""></span>Recessive&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">GG vs CC<span class="elsevierStyleHsp" style=""></span>&#43;<span class="elsevierStyleHsp" style=""></span>CG&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">&#8211;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;72&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;17&#8211;6&#46;34&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">5&#46;60&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;169&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2333879.png"
              ]
            ]
          ]
          "notaPie" => array:1 [
            0 => array:3 [
              "identificador" => "tblfn0015"
              "etiqueta" => "&#42;"
              "nota" => "<p class="elsevierStyleNotepara" id="npar0015">Significant <span class="elsevierStyleItalic">p</span>-value&#46;</p>"
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0120" class="elsevierStyleSimplePara elsevierViewall">Association of the <span class="elsevierStyleItalic">PPAR&#947;</span> gene polymorphism with DN and controls&#46;</p>"
        ]
      ]
      10 => array:8 [
        "identificador" => "tbl0030"
        "etiqueta" => "Table 6"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at6"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0135" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleSup">a</span> HWE&#44; Hardy&#8211;Weinberg equilibrium&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Study name&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases &#40;CC&#47;CG&#47;GG&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;CC&#47;CG&#47;GG&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases &#40;C&#47;G-Allele&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;C&#47;G-Allele&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of cases&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of controls&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE<span class="elsevierStyleSup">a</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Chi-square&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Bhaskar et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">14&#47;29&#47;11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">24&#47;30&#47;13&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">57&#47;51&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">78&#47;56&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">67&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;5143&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;425&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Erdogan et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">37&#47;6&#47;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">39&#47;7&#47;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">80&#47;6&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">85&#47;11&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">43&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">48&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;0513&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;797&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Maeda et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">55&#47;24&#47;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">46&#47;15&#47;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">134&#47;24&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">107&#47;15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">79&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">61&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;273&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;198&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">This study et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">94&#47;22&#47;12&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100&#47;40&#47;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">210&#47;46&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">240&#47;56&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">128&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;147&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;097&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Wu et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">130&#47;76&#47;9&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">93&#47;70&#47;15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">336&#47;94&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">256&#47;100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">215&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">178&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;723&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;125&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2333881.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0130" class="elsevierStyleSimplePara elsevierViewall">Genotype and allele frequencies of <span class="elsevierStyleItalic">PPAR&#947;</span> gene polymorphism with DN and T2DM&#46;</p>"
        ]
      ]
      11 => array:8 [
        "identificador" => "tbl0035"
        "etiqueta" => "Table 7"
        "tipo" => "MULTIMEDIATABLA"
        "mostrarFloat" => true
        "mostrarDisplay" => false
        "detalles" => array:1 [
          0 => array:3 [
            "identificador" => "at7"
            "detalle" => "Table "
            "rol" => "short"
          ]
        ]
        "tabla" => array:2 [
          "leyenda" => "<p id="spar0145" class="elsevierStyleSimplePara elsevierViewall"><span class="elsevierStyleSup">a</span> HWE&#44; Hardy&#8211;Weinberg equilibrium&#46;</p>"
          "tablatextoimagen" => array:1 [
            0 => array:2 [
              "tabla" => array:1 [
                0 => """
                  <table border="0" frame="\n
                  \t\t\t\t\tvoid\n
                  \t\t\t\t" class=""><thead title="thead"><tr title="table-row"><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Study Name&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases &#40;CC&#47;CG&#47;GG&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;CC&#47;CG&#47;GG&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Cases &#40;C&#47;G-Allele&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Controls &#40;C&#47;G-Allele&#41;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of cases&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">No of controls&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">HWE<span class="elsevierStyleSup">a</span>&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th><th class="td" title="\n
                  \t\t\t\t\ttable-head\n
                  \t\t\t\t  " align="center" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t" scope="col" style="border-bottom: 2px solid black">Chi-square&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t\t\t</th></tr></thead><tbody title="tbody"><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Deeb et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">87&#47;4&#47;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">45&#47;8&#47;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">178&#47;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">98&#47;10&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">91&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">54&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;384&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;756&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Hara et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">400&#47;15&#47;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">496&#47;45&#47;0&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">815&#47;15&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1037&#47;45&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">415&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">541&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;312&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;368&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Lin et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1348&#47;178&#47;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1328&#47;107&#47;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2874&#47;184&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2763&#47;115&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1529&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1439&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;242&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;368&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Mori et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2097&#47;103&#47;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1114&#47;96&#47;2&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">4297&#47;109&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2324&#47;100&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2203&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1212&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;214&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;539&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Pattanayak et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">158&#47;37&#47;5&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">167&#47;30&#47;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">353&#47;47&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">364&#47;36&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">200&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">200&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;233&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1&#46;419&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Phani et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">155&#47;253&#47;181&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">181&#47;254&#47;83&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">563&#47;615&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">616&#47;420&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">589&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">518&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;361&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;831&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Tripathi et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">156&#47;33&#47;1&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">154&#47;48&#47;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">345&#47;35&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">356&#47;64&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">190&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">210&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;095&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;785&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">This study et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">100&#47;40&#47;8&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">120&#47;24&#47;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">240&#47;56&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">264&#47;32&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">148&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;005&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">3&#46;74&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr><tr title="table-row"><td class="td-with-role" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t ; entry_with_role_rowhead " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">Vimaleswaran et al&#46;&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">860&#47;136&#47;4&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">840&#47;157&#47;3&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1856&#47;144&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="left" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1837&#47;163&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">1000&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">0&#46;129&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td><td class="td" title="\n
                  \t\t\t\t\ttable-entry\n
                  \t\t\t\t  " align="char" valign="\n
                  \t\t\t\t\ttop\n
                  \t\t\t\t">2&#46;301&nbsp;\t\t\t\t\t\t\n
                  \t\t\t\t</td></tr></tbody></table>
                  """
              ]
              "imagenFichero" => array:1 [
                0 => "xTab2333884.png"
              ]
            ]
          ]
        ]
        "descripcion" => array:1 [
          "en" => "<p id="spar0140" class="elsevierStyleSimplePara elsevierViewall">Genotype and allele frequencies of <span class="elsevierStyleItalic">PPAR&#947;</span> gene polymorphism with T2DM and controls&#46;</p>"
        ]
      ]
      12 => array:5 [
        "identificador" => "upi0005"
        "tipo" => "MULTIMEDIAECOMPONENTE"
        "mostrarFloat" => false
        "mostrarDisplay" => true
        "Ecomponente" => array:2 [
          "fichero" => "mmc1.docx"
          "ficheroTamanyo" => 21374
        ]
      ]
    ]
    "bibliografia" => array:2 [
      "titulo" => "References"
      "seccion" => array:1 [
        0 => array:2 [
          "identificador" => "bibs0015"
          "bibliografiaReferencia" => array:37 [
            0 => array:3 [
              "identificador" => "bib0190"
              "etiqueta" => "1"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic approaches to the molecular understanding of type 2 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "M&#46;I&#46; McCarthy"
                            1 => "P&#46; Froguel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Am J Physiol-Endocrinol Metab"
                        "fecha" => "2002"
                        "volumen" => "283"
                        "paginaInicial" => "E25"
                        "paginaFinal" => "E217"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            1 => array:3 [
              "identificador" => "bib0195"
              "etiqueta" => "2"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Markers of and risk factors for the development and progression of diabetic kidney disease"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "R&#46;J&#46; MacIsaac"
                            1 => "E&#46;I&#46; Ekinci"
                            2 => "G&#46; Jerums"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1053/j.ajkd.2013.10.048"
                      "Revista" => array:7 [
                        "tituloSerie" => "Am J Kidney Dis"
                        "fecha" => "2014"
                        "volumen" => "63"
                        "paginaInicial" => "S39"
                        "paginaFinal" => "S62"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/24461729"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S2213858716303205"
                          "estado" => "S300"
                          "issn" => "22138587"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            2 => array:3 [
              "identificador" => "bib0200"
              "etiqueta" => "3"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A glimpse of various pathogenetic mechanisms of diabetic nephropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "Y&#46;S&#46; Kanwar"
                            1 => "L&#46; Sun"
                            2 => "P&#46; Xie"
                            3 => "Liu F-y"
                            4 => "S&#46; Chen"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1146/annurev.pathol.4.110807.092150"
                      "Revista" => array:6 [
                        "tituloSerie" => "Annu Rev Pathol"
                        "fecha" => "2011"
                        "volumen" => "6"
                        "paginaInicial" => "395"
                        "paginaFinal" => "423"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21261520"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            3 => array:3 [
              "identificador" => "bib0205"
              "etiqueta" => "4"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genetic associations in diabetic nephropathy&#58; a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Mooyaart"
                            1 => "E&#46; Valk"
                            2 => "L&#46; Van Es"
                            3 => "J&#46; Bruijn"
                            4 => "E&#46; De Heer"
                            5 => "B&#46; Freedman"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1007/s00125-010-1996-1"
                      "Revista" => array:7 [
                        "tituloSerie" => "Diabetologia"
                        "fecha" => "2011"
                        "volumen" => "54"
                        "paginaInicial" => "544"
                        "paginaFinal" => "553"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21127830"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0168822712002094"
                          "estado" => "S300"
                          "issn" => "01688227"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            4 => array:3 [
              "identificador" => "bib0210"
              "etiqueta" => "5"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Genome-wide association study in individuals of South Asian ancestry identifies six new type 2 diabetes susceptibility loci"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "J&#46;S&#46; Kooner"
                            1 => "D&#46; Saleheen"
                            2 => "X&#46; Sim"
                            3 => "J&#46; Sehmi"
                            4 => "W&#46; Zhang"
                            5 => "P&#46; Frossard"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/ng.921"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Genet"
                        "fecha" => "2011"
                        "volumen" => "43"
                        "paginaInicial" => "984"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/21874001"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            5 => array:3 [
              "identificador" => "bib0215"
              "etiqueta" => "6"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Two new Loci for body-weight regulation identified in a joint analysis of genome-wide association studies for early-onset extreme obesity in French and german study groups"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46; Scherag"
                            1 => "C&#46; Dina"
                            2 => "A&#46; Hinney"
                            3 => "V&#46; Vatin"
                            4 => "S&#46; Scherag"
                            5 => "C&#46;I&#46; Vogel"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pgen.1000916"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLoS Genet"
                        "fecha" => "2010"
                        "volumen" => "6"
                        "paginaInicial" => "e1000916"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20421936"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            6 => array:3 [
              "identificador" => "bib0220"
              "etiqueta" => "7"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Associations between PPARG polymorphisms and the risk of essential hypertension"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "G&#46; Cai"
                            1 => "X&#46; Zhang"
                            2 => "W&#46; Weng"
                            3 => "G&#46; Shi"
                            4 => "S&#46; Xue"
                            5 => "B&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1371/journal.pone.0181644"
                      "Revista" => array:5 [
                        "tituloSerie" => "PLOS ONE"
                        "fecha" => "2017"
                        "volumen" => "12"
                        "paginaInicial" => "e0181644"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28727849"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            7 => array:3 [
              "identificador" => "bib0225"
              "etiqueta" => "8"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Ensembl genome browser&#46; Vogel and Motulsky&#39;s Human Genetics"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "X&#46;M&#46; Fern&#225;ndez"
                            1 => "E&#46; Birney"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "fecha" => "2010"
                        "paginaInicial" => "923"
                        "paginaFinal" => "939"
                        "editorial" => "Springer"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            8 => array:3 [
              "identificador" => "bib0230"
              "etiqueta" => "9"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Peroxisome proliferator-activated receptor &#947; polymorphism Pro12Ala is associated with nephropathy in type 2 diabetes&#58; evidence from meta-analysis of 18 studies"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Zhang"
                            1 => "S&#46; Zhu"
                            2 => "J&#46; Chen"
                            3 => "Y&#46; Tang"
                            4 => "H&#46; Hu"
                            5 => "V&#46; Mohan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Diabetes Care"
                        "fecha" => "2012"
                        "volumen" => "2"
                        "paginaInicial" => "1388"
                        "paginaFinal" => "1393"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            9 => array:3 [
              "identificador" => "bib0235"
              "etiqueta" => "10"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of peroxisome proliferator-activated receptor-&#947; in maintenance of the characteristics of mature 3T3-L1 adipocytes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "Y&#46; Tamori"
                            1 => "J&#46; Masugi"
                            2 => "N&#46; Nishino"
                            3 => "M&#46; Kasuga"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2337/diabetes.51.7.2045"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetes"
                        "fecha" => "2002"
                        "volumen" => "51"
                        "paginaInicial" => "2045"
                        "paginaFinal" => "2055"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/12086932"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            10 => array:3 [
              "identificador" => "bib0240"
              "etiqueta" => "11"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The common PPAR&#947; Pro12Ala polymorphism is associated with decreased risk of type 2 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "D&#46; Altshuler"
                            1 => "J&#46;N&#46; Hirschhorn"
                            2 => "M&#46; Klannemark"
                            3 => "C&#46;M&#46; Lindgren"
                            4 => "M&#46;-C&#46; Vohl"
                            5 => "J&#46; Nemesh"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/79216"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Genet"
                        "fecha" => "2000"
                        "volumen" => "26"
                        "paginaInicial" => "76"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/10973253"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            11 => array:3 [
              "identificador" => "bib0245"
              "etiqueta" => "12"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The impact of ethnicity on type 2 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "N&#46; Abate"
                            1 => "M&#46; Chandalia"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Diab Compl"
                        "fecha" => "2003"
                        "volumen" => "17"
                        "paginaInicial" => "39"
                        "paginaFinal" => "58"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            12 => array:3 [
              "identificador" => "bib0250"
              "etiqueta" => "13"
              "referencia" => array:1 [
                0 => array:1 [
                  "referenciaCompleta" => "World Health Organization&#46; Definition&#44; diagnosis and classification of diabetes mellitus and its complications&#58; report of a WHO consultation&#46; Part-1&#44; Diagnosis and classification of diabetes mellitus&#46; 1999&#46;"
                ]
              ]
            ]
            13 => array:3 [
              "identificador" => "bib0255"
              "etiqueta" => "14"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The isolation of high molecular weight eukaryotic DNA&#46; Nucleic Acids"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:1 [
                            0 => "C&#46; Mathew"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Libro" => array:4 [
                        "fecha" => "1984"
                        "paginaInicial" => "4"
                        "paginaFinal" => "31"
                        "editorial" => "Springer"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            14 => array:3 [
              "identificador" => "bib0260"
              "etiqueta" => "15"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "An efficient procedure for genotyping single nucleotide polymorphisms"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "S&#46; Ye"
                            1 => "S&#46; Dhillon"
                            2 => "X&#46; Ke"
                            3 => "A&#46;R&#46; Collins"
                            4 => "I&#46;N&#46; Day"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/nar/29.17.e88"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nucleic Acids Res"
                        "fecha" => "2001"
                        "volumen" => "29"
                        "paginaInicial" => "e88"
                        "paginaFinal" => "e90"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11522844"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            15 => array:3 [
              "identificador" => "bib0265"
              "etiqueta" => "16"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association between NOS1 gene polymorphisms and Schizophrenia in Asian and Caucasian populations&#58; a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46;S&#46; Ahmed"
                            1 => "R&#46;A&#46; Husain"
                            2 => "S&#46; Kumar"
                            3 => "V&#46; Ramakrishnan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:6 [
                        "tituloSerie" => "Neuromol Med"
                        "fecha" => "2017"
                        "volumen" => "19"
                        "paginaInicial" => "452"
                        "paginaFinal" => "461"
                        "itemHostRev" => array:3 [
                          "pii" => "S2213858716303205"
                          "estado" => "S300"
                          "issn" => "22138587"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            16 => array:3 [
              "identificador" => "bib0270"
              "etiqueta" => "17"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of rs1801582 and rs1801334 PARK2 polymorphisms with risk of Parkinson&#39;s disease&#58; a case&#8211;control study in South India and meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "V&#46; Ramakrishnan"
                            1 => "T&#46;A&#46; Alphonsa"
                            2 => "R&#46;A&#46; Husain"
                            3 => "S&#46;S&#46; Ahmed"
                            4 => "K&#46; Subramaniyan"
                            5 => "S&#46; Kumar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Meta Gene"
                        "fecha" => "2016"
                        "volumen" => "10"
                        "paginaInicial" => "32"
                        "paginaFinal" => "38"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            17 => array:3 [
              "identificador" => "bib0275"
              "etiqueta" => "18"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Predicting the extent of heterogeneity in meta-analysis&#44; using empirical data from the Cochrane Database of Systematic Reviews"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "R&#46;M&#46; Turner"
                            1 => "J&#46; Davey"
                            2 => "M&#46;J&#46; Clarke"
                            3 => "S&#46;G&#46; Thompson"
                            4 => "J&#46;P&#46; Higgins"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/ije/dys041"
                      "Revista" => array:6 [
                        "tituloSerie" => "Int J Epidemiol"
                        "fecha" => "2012"
                        "volumen" => "41"
                        "paginaInicial" => "818"
                        "paginaFinal" => "827"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/22461129"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            18 => array:3 [
              "identificador" => "bib0280"
              "etiqueta" => "19"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Meta-analysis in clinical trials revisited"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:2 [
                            0 => "R&#46; DerSimonian"
                            1 => "N&#46; Laird"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cct.2015.09.002"
                      "Revista" => array:7 [
                        "tituloSerie" => "Contemp Clin Trials"
                        "fecha" => "2015"
                        "volumen" => "45"
                        "paginaInicial" => "139"
                        "paginaFinal" => "145"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/26343745"
                            "web" => "Medline"
                          ]
                        ]
                        "itemHostRev" => array:3 [
                          "pii" => "S0022347613015618"
                          "estado" => "S300"
                          "issn" => "00223476"
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            19 => array:3 [
              "identificador" => "bib0285"
              "etiqueta" => "20"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Bias in meta-analysis detected by a simple&#44; graphical test"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "M&#46; Egger"
                            1 => "G&#46;D&#46; Smith"
                            2 => "M&#46; Schneider"
                            3 => "C&#46; Minder"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1136/bmj.315.7109.629"
                      "Revista" => array:6 [
                        "tituloSerie" => "BMJ"
                        "fecha" => "1997"
                        "volumen" => "315"
                        "paginaInicial" => "629"
                        "paginaFinal" => "634"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9310563"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            20 => array:3 [
              "identificador" => "bib0290"
              "etiqueta" => "21"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "PSEN1 gene polymorphisms in Caucasian Alzheimer&#39;s disease&#58; a meta-analysis"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "V&#46; Ramakrishnan"
                            1 => "R&#46;A&#46; Husain"
                            2 => "S&#46;S&#46; Ahmed"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.cca.2017.08.016"
                      "Revista" => array:6 [
                        "tituloSerie" => "Clin Chim Acta"
                        "fecha" => "2017"
                        "volumen" => "473"
                        "paginaInicial" => "65"
                        "paginaFinal" => "70"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/28821390"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            21 => array:3 [
              "identificador" => "bib0295"
              "etiqueta" => "22"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of the ACE ID and PPARG P12A polymorphisms in genetic susceptibility of diabetic nephropathy in a South Indian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "L&#46;V&#46; Bhaskar"
                            1 => "S&#46; Mahin"
                            2 => "R&#46;T&#46; Ginila"
                            3 => "P&#46; Soundararajan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Nephro-urology"
                        "fecha" => "2013"
                        "volumen" => "5"
                        "paginaInicial" => "813"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            22 => array:3 [
              "identificador" => "bib0300"
              "etiqueta" => "23"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The relationship of the peroxisome proliferator-activated receptor-gamma 2 exon 2 and exon 6 gene polymorphism in Turkish type 2 diabetic patients with and without nephropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "M&#46; Erdogan"
                            1 => "M&#46; Karadeniz"
                            2 => "Z&#46; Eroglu"
                            3 => "B&#46; Tezcanl&#305;"
                            4 => "N&#46; Selvi"
                            5 => "C&#46; Yilmaz"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Diab Res Clin Pract"
                        "fecha" => "2007"
                        "volumen" => "78"
                        "paginaInicial" => "355"
                        "paginaFinal" => "359"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            23 => array:3 [
              "identificador" => "bib0305"
              "etiqueta" => "24"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Peroxisome proliferator-activated receptor &#947; gene polymorphism is associated with serum triglyceride levels and body mass index in Japanese type 2 diabetic patients"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "A&#46; Maeda"
                            1 => "T&#46; Gohda"
                            2 => "K&#46; Funabiki"
                            3 => "S&#46; Horikoshi"
                            4 => "Y&#46; Tomino"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1002/jcla.20045"
                      "Revista" => array:6 [
                        "tituloSerie" => "J Clin Lab Anal"
                        "fecha" => "2004"
                        "volumen" => "18"
                        "paginaInicial" => "317"
                        "paginaFinal" => "321"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/15543562"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            24 => array:3 [
              "identificador" => "bib0310"
              "etiqueta" => "25"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association and interaction analyses of genetic variants in ADIPOQ&#44; ENPP1&#44; GHSR PPAR&#947; and TCF7L2 genes for diabetic nephropathy in a Taiwanese population with type 2 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "L&#46;S&#46;-H&#46; Wu"
                            1 => "C&#46;-H&#46; Hsieh"
                            2 => "D&#46; Pei"
                            3 => "Y&#46;-J&#46; Hung"
                            4 => "S&#46;-W&#46; Kuo"
                            5 => "E&#46; Lin"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1093/ndt/gfp271"
                      "Revista" => array:6 [
                        "tituloSerie" => "Nephrol Dial Transplant"
                        "fecha" => "2009"
                        "volumen" => "24"
                        "paginaInicial" => "3360"
                        "paginaFinal" => "3366"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19506043"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            25 => array:3 [
              "identificador" => "bib0315"
              "etiqueta" => "26"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "A Pro12Ala substitution in PPAR&#947;2 associated with decreased receptor activity&#44; lower body mass index and improved insulin sensitivity"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "S&#46;S&#46; Deeb"
                            1 => "L&#46; Fajas"
                            2 => "M&#46; Nemoto"
                            3 => "J&#46; Pihlajam&#228;ki"
                            4 => "L&#46; Mykk&#228;nen"
                            5 => "J&#46; Kuusisto"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1038/3099"
                      "Revista" => array:5 [
                        "tituloSerie" => "Nat Genet"
                        "fecha" => "1998"
                        "volumen" => "20"
                        "paginaInicial" => "284"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/9806549"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            26 => array:3 [
              "identificador" => "bib0320"
              "etiqueta" => "27"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The Pro12Ala polymorphism in PPAR &#947;2 may confer resistance to type 2 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46; Hara"
                            1 => "T&#46; Okada"
                            2 => "K&#46; Tobe"
                            3 => "K&#46; Yasuda"
                            4 => "Y&#46; Mori"
                            5 => "H&#46; Kadowaki"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Biochem Biophys Res Commun"
                        "fecha" => "2000"
                        "volumen" => "271"
                        "paginaInicial" => "212"
                        "paginaFinal" => "216"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            27 => array:3 [
              "identificador" => "bib0325"
              "etiqueta" => "28"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association study of genetic variants in eight genes&#47;loci with type 2 diabetes in a Han Chinese population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Y&#46; Lin"
                            1 => "P&#46; Li"
                            2 => "L&#46; Cai"
                            3 => "B&#46; Zhang"
                            4 => "X&#46; Tang"
                            5 => "X&#46; Zhang"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1186/1471-2350-11-97"
                      "Revista" => array:5 [
                        "tituloSerie" => "BMC Med Genet"
                        "fecha" => "2010"
                        "volumen" => "11"
                        "paginaInicial" => "97"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/20550665"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            28 => array:3 [
              "identificador" => "bib0330"
              "etiqueta" => "29"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The Pro12&#8594; Ala substitution in PPAR-&#947; is associated with resistance to development of diabetes in the general population&#58; possible involvement in impairment of insulin secretion in individuals with type 2 diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "H&#46; Mori"
                            1 => "H&#46; Ikegami"
                            2 => "Y&#46; Kawaguchi"
                            3 => "S&#46; Seino"
                            4 => "N&#46; Yokoi"
                            5 => "J&#46; Takeda"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.2337/diabetes.50.4.891"
                      "Revista" => array:6 [
                        "tituloSerie" => "Diabetes"
                        "fecha" => "2001"
                        "volumen" => "50"
                        "paginaInicial" => "891"
                        "paginaFinal" => "894"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/11289058"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            29 => array:3 [
              "identificador" => "bib0335"
              "etiqueta" => "30"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Role of peroxisome proliferator-activated receptor gamma gene polymorphisms in type 2 diabetes mellitus patients of West Bengal&#44; India"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:6 [
                            0 => "A&#46;K&#46; Pattanayak"
                            1 => "B&#46; Bankura"
                            2 => "N&#46; Balmiki"
                            3 => "T&#46;K&#46; Das"
                            4 => "S&#46; Chowdhury"
                            5 => "M&#46; Das"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "J Diab Invest"
                        "fecha" => "2014"
                        "volumen" => "5"
                        "paginaInicial" => "188"
                        "paginaFinal" => "191"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            30 => array:3 [
              "identificador" => "bib0340"
              "etiqueta" => "31"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Implications of critical PPAR&#947;2 ADIPOQ and FTO gene polymorphisms in type 2 diabetes and obesity-mediated susceptibility to type 2 diabetes in an Indian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "N&#46;M&#46; Phani"
                            1 => "M&#46; Vohra"
                            2 => "S&#46; Rajesh"
                            3 => "P&#46; Adhikari"
                            4 => "S&#46;K&#46; Nagri"
                            5 => "S&#46;C&#46; D&#39;Souza"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Mol Genet Genom"
                        "fecha" => "2016"
                        "volumen" => "291"
                        "paginaInicial" => "193"
                        "paginaFinal" => "204"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            31 => array:3 [
              "identificador" => "bib0345"
              "etiqueta" => "32"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Type 2 diabetes in a central Indian population&#58; association with PPARG2 P121A allele but not ENPP1 K121Q"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "A&#46;K&#46; Tripathi"
                            1 => "S&#46; Shukla"
                            2 => "M&#46;K&#46; Dwivedi"
                            3 => "J&#46;K&#46; Tripathi"
                            4 => "U&#46;K&#46; Chauhan"
                            5 => "M&#46; Indurkar"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Adv Genomics Genet"
                        "fecha" => "2013"
                        "volumen" => "3"
                        "paginaInicial" => "1"
                        "paginaFinal" => "9"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            32 => array:3 [
              "identificador" => "bib0350"
              "etiqueta" => "33"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Evidence for an association with type 2 diabetes mellitus at the PPARG locus in a South Indian population"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "K&#46;S&#46; Vimaleswaran"
                            1 => "V&#46; Radha"
                            2 => "M&#46;G&#46; Jayapriya"
                            3 => "S&#46; Ghosh"
                            4 => "P&#46;P&#46; Majumder"
                            5 => "M&#46;S&#46; Rao"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:2 [
                      "doi" => "10.1016/j.metabol.2009.07.034"
                      "Revista" => array:6 [
                        "tituloSerie" => "Metab-Clin Exp"
                        "fecha" => "2010"
                        "volumen" => "59"
                        "paginaInicial" => "457"
                        "paginaFinal" => "462"
                        "link" => array:1 [
                          0 => array:2 [
                            "url" => "https://www.ncbi.nlm.nih.gov/pubmed/19846173"
                            "web" => "Medline"
                          ]
                        ]
                      ]
                    ]
                  ]
                ]
              ]
            ]
            33 => array:3 [
              "identificador" => "bib0355"
              "etiqueta" => "34"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "Association of the PPARGC1A gene polymorphism with diabetic nephropathy in an Asian Indian population &#40;CURES-41&#41;"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:4 [
                            0 => "S&#46;B&#46; Gayathri"
                            1 => "V&#46; Radha"
                            2 => "K&#46;S&#46; Vimaleswaran"
                            3 => "V&#46; Mohan"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:5 [
                        "tituloSerie" => "Metab Syndrome Relat Disord"
                        "fecha" => "2010"
                        "volumen" => "8"
                        "paginaInicial" => "119"
                        "paginaFinal" => "126"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            34 => array:3 [
              "identificador" => "bib0360"
              "etiqueta" => "35"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The role of peroxisome proliferator-activated receptors and their transcriptional coactivators gene variations in human trainability&#58; a systematic review"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:5 [
                            0 => "M&#46; Petr"
                            1 => "P&#46; Stastny"
                            2 => "A&#46; Zajac"
                            3 => "J&#46;J&#46; Tufano"
                            4 => "A&#46; Maciejewska-Skrendo"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:4 [
                        "tituloSerie" => "Int J Mol Sci"
                        "fecha" => "2018"
                        "volumen" => "19"
                        "paginaInicial" => "1472"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            35 => array:3 [
              "identificador" => "bib0365"
              "etiqueta" => "36"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "New insights into the PPAR&#947; agonists for the treatment of diabetic nephropathy"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => true
                          "autores" => array:6 [
                            0 => "Z&#46; Jia"
                            1 => "Y&#46; Sun"
                            2 => "G&#46; Yang"
                            3 => "A&#46; Zhang"
                            4 => "S&#46; Huang"
                            5 => "K&#46;M&#46; Heiney"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:2 [
                        "tituloSerie" => "PPAR Res"
                        "fecha" => "2014"
                      ]
                    ]
                  ]
                ]
              ]
            ]
            36 => array:3 [
              "identificador" => "bib0370"
              "etiqueta" => "37"
              "referencia" => array:1 [
                0 => array:2 [
                  "contribucion" => array:1 [
                    0 => array:2 [
                      "titulo" => "The renoprotective actions of peroxisome proliferator-activated receptors agonists in diabetes"
                      "autores" => array:1 [
                        0 => array:2 [
                          "etal" => false
                          "autores" => array:3 [
                            0 => "M&#46;C&#46; Thomas"
                            1 => "K&#46;A&#46; Jandeleit-Dahm"
                            2 => "C&#46; Tikellis"
                          ]
                        ]
                      ]
                    ]
                  ]
                  "host" => array:1 [
                    0 => array:1 [
                      "Revista" => array:2 [
                        "tituloSerie" => "PPAR Res"
                        "fecha" => "2012"
                      ]
                    ]
                  ]
                ]
              ]
            ]
          ]
        ]
      ]
    ]
    "agradecimientos" => array:1 [
      0 => array:4 [
        "identificador" => "xack471369"
        "titulo" => "Acknowledgment"
        "texto" => "<p id="par0120" class="elsevierStylePara elsevierViewall">All the authors were thankful to the patients and controls for participating in the study&#46; The author &#40;AH&#41; wishes to acknowledge the Chettinad Academy of Research and Education &#40;CARE&#41; for providing the Chettinad Research fellowship&#46;</p>"
        "vista" => "all"
      ]
    ]
  ]
  "idiomaDefecto" => "en"
  "url" => "/02116995/0000004000000003/v3_202007050614/S0211699520300345/v3_202007050614/en/main.assets"
  "Apartado" => array:4 [
    "identificador" => "42448"
    "tipo" => "SECCION"
    "en" => array:2 [
      "titulo" => "Originales"
      "idiomaDefecto" => true
    ]
    "idiomaDefecto" => "en"
  ]
  "PDF" => "https://static.elsevier.es/multimedia/02116995/0000004000000003/v3_202007050614/S0211699520300345/v3_202007050614/en/main.pdf?idApp=UINPBA000064&text.app=https://revistanefrologia.com/"
  "EPUB" => "https://multimedia.elsevier.es/PublicationsMultimediaV1/item/epub/S0211699520300345?idApp=UINPBA000064"
]

Información del artículo

ISSN: 02116995
Idioma original: Inglés

DOI:10.1016/j.nefro.2020.01.005

Datos actualizados diariamente

año/Mes	Html	Pdf	Total

2024 Noviembre	21	8	29
2024 Octubre	130	51	181
2024 Septiembre	99	35	134
2024 Agosto	133	87	220
2024 Julio	127	37	164
2024 Junio	488	79	567
2024 Mayo	133	53	186
2024 Abril	122	66	188
2024 Marzo	105	43	148
2024 Febrero	87	53	140
2024 Enero	64	72	136
2023 Diciembre	79	44	123
2023 Noviembre	112	61	173
2023 Octubre	164	44	208
2023 Septiembre	85	39	124
2023 Agosto	83	43	126
2023 Julio	112	39	151
2023 Junio	104	32	136
2023 Mayo	140	74	214
2023 Abril	86	30	116
2023 Marzo	120	37	157
2023 Febrero	104	40	144
2023 Enero	106	50	156
2022 Diciembre	119	60	179
2022 Noviembre	129	55	184
2022 Octubre	171	82	253
2022 Septiembre	115	60	175
2022 Agosto	104	69	173
2022 Julio	108	73	181
2022 Junio	147	63	210
2022 Mayo	131	48	179
2022 Abril	133	107	240
2022 Marzo	115	82	197
2022 Febrero	110	62	172
2022 Enero	100	51	151
2021 Diciembre	88	48	136
2021 Noviembre	89	59	148
2021 Octubre	123	68	191
2021 Septiembre	52	56	108
2021 Agosto	90	55	145
2021 Julio	64	74	138
2021 Junio	59	35	94
2021 Mayo	70	61	131
2021 Abril	179	83	262
2021 Marzo	117	88	205
2021 Febrero	104	45	149
2021 Enero	61	28	89
2020 Diciembre	62	19	81
2020 Noviembre	49	30	79
2020 Octubre	45	21	66
2020 Septiembre	81	44	125
2020 Agosto	160	50	210
2020 Julio	93	56	149
2020 Junio	101	64	165
2020 Mayo	96	38	134

Mostrar todo

Indexada en:

Síguenos:

Estadísticas

Indexada en:

Síguenos:

Estadísticas

Suscríbase a la newsletter