Nefrología Vol. 37 Nº 3 Año 2017
Nefrologia (Madr.) 2017;37:301-10 | doi: 10.1016/j.nefro.2016.11.024

CTNS molecular genetics profile in a Persian nephropathic cystinosis population


a Department of Medical Genetics and Molecular Biology, Faculty of Medicine, Iran University of Medical Sciences (IUMS), Tehran, Iran
b Department of Pediatrics, Faculty of Medicine, Ali Asghar Children Hospital, Iran University of Medical Sciences (IUMS), Tehran, Iran
c Section on Human Biochemical Genetics, Medical Genetics Branch, National Human Genome Research Institute, NIH, Bethesda, MD, USA
d NIH Undiagnosed Diseases Program, Common Fund, Office of the Director, NIH, Bethesda, MD, USA
Resumen
Objetivo

En este informe, documentamos las mutaciones del gen CTNS de 28 pacientes iraníes con cistinosis nefropática y una edad de 1-17 años. En un principio, todos presentaron retraso del desarrollo, poliuria y polidipsia.

Métodos

En primer lugar, un nefrólogo pediátrico diagnosticó la cistinosis y luego los pacientes fueron trasladados a la clínica genética de la Universidad de Ciencias Médicas de Irán para consulta y análisis molecular, que incluía la multiplicación por reacción en cadena de la polimerasa (PCR), para determinar la existencia o ausencia de la deleción del fundador del 57kb en el CTNS, seguida por la secuenciación directa de los exones de codificación del CTNS.

Resultados

La deleción frecuente del 57kb no se observó en ninguno de los 28 pacientes iraníes. En 14 de los 28 pacientes (50%) se observaron mutaciones en los exones 6 y 7. No se detectó ninguna mutación en el exón 5 y solo un paciente (3,6%) con cistinosis mostró una deleción del 4pb, anteriormente comunicada, en el exón 3 del CTNS. De ellos, 4 pacientes (14,3%) tenían una mutación anteriormente comunicada (c.969C > A; p.N323K) en el exón 11 y 5 (18%) tenían nuevas deleciones homocigóticas en el exón 6 que produjeron el vaciamiento prematuro de la proteína. Entre estas deleciones se puede citar c.323delA; p.Q108RfsX10 en 3 personas y c.257-258delCT; p.S86FfsX37 en 2 casos. Otras mutaciones con desplazamiento del marco de lectura fueron todas nuevas deleciones/inserciones de un par de bases únicas homocigóticas, incluyendo una en el exón 9 del CTNS (c.661insT; p.V221CfsX6) y 4 (14,3%) en el exón 4, es decir, c.92insG; p.V31GfsX28 en 2 y c.120delC; p.T40TfsX10 en 2. En total, en nuestros pacientes se identificaron 8 mutaciones anteriormente comunicadas y 8 mutaciones nuevas. La única mutación del sitio de empalme detectada (IVS3-2A>C) estaba asociada con la mutación de inserción en el exón 9.

Conclusión

Este estudio, el primer análisis genético molecular de pacientes iraníes con cistinosis nefropática de carácter no específicamente étnico, puede servir como guía para el diagnóstico molecular de la cistinosis en Irán.

Abstract
Purpose

In this report, we document the CTNS gene mutations of 28 Iranian patients with nephropathic cystinosis age 1–17 years. All presented initially with severe failure to thrive, polyuria, and polydipsia.

Methods

Cystinosis was primarily diagnosed by a pediatric nephrologist and then referred to the Iran University of Medical Sciences genetics clinic for consultation and molecular analysis, which involved polymerase chain reaction (PCR) amplification to determine the presence or absence of the 57-kb founder deletion in CTNS, followed by direct sequencing of the coding exons of CTNS.

Results

The common 57-kb deletion was not observed in any of the 28 Iranian patients. In 14 of 28 patients (50%), mutations were observed in exons 6 and 7. No mutation was detected in exon 5, and only one (3.6%) patient with cystinosis showed a previously reported 4-bp deletion in exon 3 of CTNS. Four patients (14.3%) had a previously reported mutation (c.969C>A; p.N323K) in exon 11, and five (18%) had novel homozygous deletions in exon 6 leading to premature truncation of the protein. These deletions included c.323delA; p.Q108RfsX10 in three individuals and c.257-258delCT; p.S86FfsX37 in two cases. Other frame-shift mutations were all novel homozygous single base pair deletion/insertions including one in CTNS exon 9 (c.661insT; p.V221CfsX6), and four (14.3%) in exon 4, i.e., c.92insG; p.V31GfsX28 in two and c.120delC; p.T40TfsX10 in two. In total, we identified eight previously reported mutations and eight novel mutations in our patients. The only detected splice site mutation (IVS3-2A>C) was associated with the insertion mutation in the exon 9.

Conclusion

This study, the first molecular genetic analysis of non-ethnic-specific Iranian nephropathic cystinosis patients, may provide guidance for molecular diagnostics of cystinosis in Iran.

Key words:
Palabras Clave:
Introduction

Cystinosis, OMIM# 219800, is a lysosomal storage disease due to impaired transport of cystine across the lysosomal membrane. The gene defect involves CTNS (OMIM 606272; GenBank NM_001031681), located on chromosome 17p13,1 and results in cystine accumulation in most cells and tissues of the body, including the kidneys, eyes, bone marrow, intestines, liver, and spleen. Cystinosis is inherited in an autosomal recessive fashion; all affected individuals have biallelic CTNS mutations.

Cystinosis has been divided into three categories: nephropathic cystinosis, intermediate cystinosis and nonnephropathic or ocular cystinosis, although these subtypes actually reflect a continuum of severity. As the most common and severe phenotype, nephropathic cystinosis manifests in infancy, causing poor growth and renal Fanconi syndrome, characterized by polyuria, polydipsia, proteinuria, acidosis and urinary loss of various salts and nutrients. Renal tubular dysfunction leads to the loss of essential minerals, impairing growth and causing hypophosphatemic rickets. By one year of age, cystine crystals are generally apparent in the corneas on slit lamp examination by an experienced ophthalmologist. These crystals cause pain and increased sensitivity to light.2,3 untreated children experience complete kidney failure by approximately 10 years of age. Long-term complications include muscle deterioration, blindness, inability to swallow, diabetes, hypothyroidism, central nervous system involvement, and male infertility.

The signs of intermediate cystinosis are the same as for nephropathic cystinosis, but they typically appear in adolescence rather than in infancy. Kidney failure and corneal crystals are the most important early features of this disease. If intermediate cystinosis is left untreated, complete kidney failure can occur in the late teens to mid-1920s.3 Individuals with ocular cystinosis typically experience photophobia, but usually do not develop kidney failure or other clinical manifestations of cystinosis. Due to the absence of severe symptoms, the age at which this form of cystinosis is diagnosed varies widely.4,5

Kidney transplantation has significantly extended the lives of patients with nephropathy cystinosis. In addition, the cysteine-lowering drug, cystamine, depletes cells of cysteine by combining with cystine to produce cysteine and cysteine-cystamine mixed disulfide, which exits cystinotic lysosomes via a functional lysine carrier.6 This therapy has been salutary with respect to preservation of renal function, stimulation of growth, and prevention of the late, nonrenal complications of cystinosis.

The CTNS gene has 13 exons, but exons 3–12 are protein-coding; biallelic mutations lead to significant loss of the lysosomal cystine transporter, cystinosin.3,7–9 Approximately 200 CTNS mutations have been reported in cystinosis patients, the most common is a 57-kb deletion responsible for 50% of all the North American and Northern European cases.10–20 Here we report the CTNS mutations present in 28 Iranian patients of diverse ethnicity, providing the first molecular genetic study of cystinosis in this population.

MethodsPatients

Studies were conducted in patients, family members and normal control subjects after informed consent was obtained according to Iran University ethical committee codes. Blood samples were collected from individuals with nephropathic cystinosis and their parents who were attending Ali-Asghar Children Hospital of Iran University of Medical Science. The clinical and molecular genetics survey was performed in accordance with the Declaration of Helsinki.

During two years of study, 28 individuals (16 males and 12 females) from 28 unrelated consanguineous families participated in our studies. The patients were from different Persian ethnic groups of Iran, and inclusion required signs and symptoms of Fanconi syndrome and/or the presence of cystine crystals in the cornea, documented by a nephrologist and/or ophthalmologist, respectively. All patients had a clinical history consistent with the disease, including kidney and/or eye involvement; patients were generally referred to our clinic for genetic counseling and molecular genetic analysis by pediatric nephrologists.

PCR amplification of CTNS

Genomic DNA was extracted as previously described.7 The 5′ UTR and the open reading frame (ORF) of CTNS (with the exon–intron boundaries) were amplified by independent PCR amplifications utilizing exon-specific primer pairs, which the sequences of some are listed in Table 1. PCR was performed in a final volume of 50μl containing 200μM dNTP, 1×Taq DNA polymerase buffer, various concentration of MgCl2, 2U Taq proof-reading (Pfu) DNA polymerase (Cinagen, Tehran, Iran), 200ng genomic DNA and 10pmol of each primer. After initial denaturation for 5min at 95°C, 35 cycles of amplification were performed as follows: 30s at 95°C, 30s at 51–57°C (depends on the primer pairs) and 30s at 72°C. PCR products were evaluated on a 1.5% agarose gel stained with RedSafe (Cinagen, Tehran, Iran).

Table 1.

CTNS gene-specific primers.

Primer symbol  Primer sequence  Product size 
CTNS-3F  GGGGGCACTTTACACAACC  509bp
CTNS-3R  TCTGGCTCTTTGCAGAACAC 
CTNS-4F  CCAGGTTTCTAAGCGTGAGC  709bp
CTNS-4R  GTCACACAGGACTCTTCCCAT 
CTNS-5F  GCACCTAGCATTTCCTAAGCCTAAC  447bp
CTNS-5R  CCGGTAAGAACGTTTACATTCCC 
CTNS-7F (ex. 6–7)  GGAGGTTCAAGTTGGCTGGTG  675bp
CTNS-7R (ex. 6–7)  TTCGCACTGGGACAACTTTCTG 
CTNS-10F  CAGTTCTGCCAAGTAGGAACAAAG  596bp
CTNS-10R  TGGCTTTCCGTCCTGTTTC 
CTNS-11F  ACCGCTTTTGTTTGGAGGG  780bp
CTNS-12R  GGACGAAGGCAGGCTATTGA 
DNA sequencing

Sequence analysis of PCR products from the promoter region and all exons was performed after purification of PCR products (PCR product purification kit, Roche). Both strands were sequenced using the Big Dye Termination system in an ABI 310 capillary sequencer (Macrogen, South Korea). Sequencing results were analyzed using bioinformatic tools (http://www.ncbi.nlm.nih.gov/gorf/bl2.html).

Results

GAP-PCR was carried out in all samples, and no patient showed the 57kb CTNS deletion in either the homozygous or heterozygous state (Fig. 1). Direct sequencing of the entire CTNS gene demonstrated alterations in all patients. In 14 of 28 patients (50%), the alterations were observed in exons 6 and 7. Four patients (14.15%) had c.969C>A; p.N323K, in exon 11 of the CTNS gene which was previously reported, 3 were heterozygous and one was homozygous. Three patients (11%) were homozygous for a single base pair deletion in nucleic acid position 323 (c.323delA) in exon 6, leading to premature truncation of the protein (p.Q108RfsX10) (Fig. 2A). Also in exon 6, two patients (7.2%) showed homozygosity for an unreported deletion of two nucleotides, (c.257-258delCT; p.S86FfsX37). Two patients were homozygous for a novel single base pair insertion (c.92insG; p.V31GfsX28) in exon 4, and two others had a homozygous deletion (c.120delC; p.T40TfsX10) in exon 4. Another frame-shift mutation was identified as a novel homozygous single base pair deletion in exon 9 (c.661insT; p.V221CfsX6) in one patient (Fig. 2B). Also, one patient had a previously reported mutation (http://www.ncbi.nlm.nih.gov/clinvar/variation/188834/), c.18-21del GACT; p.T7fsX7, in CTNS exon 3. The variations in -303 5′ UTR of the CTNS, previously reported for ocular cystinosis,15 were detected in 2 patients in our study too.

Fig. 1.

Genomic PCR amplifies CTNS amplicons. Genomic PCR amplifies the exons using the gene-specific pairs of primers. The common 57-kb deletion was not observed in any of the 28 Iranian patients. The PCR products were subjects for Sanger sequencing using relevant forward and reverse primers after purification of PCR products (PCR product purification kit, Roche).

Fig. 2.

Chromatogram (Chromas software version 2.4.1) for the region containing some novel mutations. Red arrow shows the substituted nucleotide. Sequence analysis of PCR products from the promoter region and all exons was performed. Both strands were sequenced using the Big Dye Termination system in an ABI 310 capillary sequencer (Macrogen, South Korea). A, shows a single base pair deletion in nucleic acid position 323 (c.323delA) in exon 6, leading to premature truncation of the protein p.Q108RfsX10 which was observed in three patients (11%) in homozygous state. B, c.661insT; p.V221CfsX6 is a novel homozygous single base pair deletion in exon 9 observed in one patient. C, the variant c.779C>T; p.T260I (in exon 10) was detected in 18 of 28 (64%) patients. D, c.261T>A; p.F87L in exon 6 of CTNS is the most common mutation in our population which was observed in six patients (21.4%) in heterozygote and homozygote states.

In our population, the variant c.779C>T; p.T260I (in exon 10) was detected in 18 of 28 (64%) patients with nephropathic cystinosis (Fig. 2C). Furthermore, a second CTNS mutation was detected in 16 of 18 patients. The most common mutation in our population was c.261T>A; p.F87L in exon 6 of CTNS; this was observed in six patients (21.4%) (Fig. 2D).

Five patients were compound heterozygous for the mutations c.73A>T; p.S25C/c.261T>A; pF87L, c.969C>A; p.N323K/c.1015G>A; p.G339R, c.73A>T; p.S25C/c.969C>A; p.N323K, and c.261T>A; pF87L/c.969C>A; p.N323K.

A summary of all identified mutations is depicted in Table 2. In addition, a number of SNPs were found in coding exons of the CTNS gene (Table 3). A total of 68 healthy non-related Persian individuals were screened for the novel mutations found in this survey; none carried any of the changes.

Table 2.

Summarized mutations detected in patients with cystinosis in Iran. All variations have been verified with the mutations reported in ClinVar (http://www.ncbi.nlm.nih.gov/clinvar/?term=ctns%5Bgene%5D).

No.  Amplicone (size)
Patient code 
Exon 1–2
(809bp) 
Exon 3
(509bp) 
Exon 4
(121bp) 
Exon 5
(85bp) 
Exon 6–7
(1373bp) 
Exon 8–9
(291bp) 
Exon 10
(–bp) 
Exon 11–12
(118bp) 
Description 
A01      c.119C>G; p.T40S (Het)
c.124G>A; p.V42I (Het) 
      c.779C>T; p.T260I  c.969C>A; p.N323K (Het)  Juvenile nephropathic cystinosis 
A02          c.250A>G; p.N84D (Hom)    c.779C>T; p.T260I    Novel 
A03      c.73A>T; p.S25C    c.261T>A; p.F87L    c.779C>T; p.T260I    Novel (Comp. Het) 
A04      c.73A>T; p.S25C    c.261T>A; p.F87L    c.779C>T; p.T260I    Novel (Comp. Het) 
A05      c.92insG; p.V31GfsX28 (Hom)            Novel 
A06              c.779C>T; p.T260I (Hom)  IVS11+70T   
A08        c.194A>G; p.K65R (SNP)      c.779C>T; p.T260I  c.969C>A; p.N323K (Het)
c.1015G>A; p.G339R (Het) 
Juvenile nephropathic cystinosis (Comp. Het) 
A09  -303 TG Ins
5′ UTR (Hom) 
          c.779C>T; p.T260I    Ocular cystinosis 
A10      c.120delC; p.T40TfsX10 (Hom)        c.779C>T; p.T260I    Novel 
10  19            c.647C>G; p.T216R19 (Hom)      Novel 
11  A47          c.261T>A; p.F87L (Hom)        Novel 
12  A51  -303 G>T
5′ UTR 
              Ocular cystinosis 
13  A52      c.120delC; p.T40TfsX10 (Hom)            Novel 
14  A53      c.92inserG; p.V31GfsX28 (Hom)            Novel 
15  A60    c.18-21del GACT; p.T7fsX7 (Hom)              – 
16  A61          c.261T>A; p.F87L (Hom)    c.779C>T; p.T260I    Novel 
17  A63      IVS3-2A>C      c.661insT; p.V221CfsX6 (Hom)      Novel 
18  A156          c.250A>G; p.N84D (Hom)    c.779C>T; p.T260I    Novel 
19  A160      c.73A>T; p.S25C        c.779C>T; p.T260I  c.969C>A; p.N323K  Juvenile nephropathic cystinosis (Comp. Het) 
20  A163          c.323delA; p.Q108RfsX10 (Hom)    c.779C>T; p.T260I    Novel 
21  F72          c.323delA; p.Q108RfsX10 (Hom)    c.779C>T; p.T260I    Novel 
22  F73          c.261T>A; p.F87L (Hom)    c.779C>T; p.T260I    Novel 
23  F74          c.257-258delCT; p.S86FfsX37 (Hom)    c.779C>T; p.T260I    Novel 
24  F75          c.261T>A; p.F87L    c.779C>T; p.T260I  c.969C>A; p.N323K (Het)  Juvenile nephropathic cystinosis (Comp. Het) 
25  F80          c.257-258delCT; p.S86FfsX37 (Hom)
 
      Novel 
26  F97              c.779C>T; p.T260I (Hom)     
27  F129          c.261T>A; p.F87L (Hom)    c.779C>T; p.T260I    Novel 
28  F616          c.323delA; p.Q108RfsX10 (Hom)        Novel 
Table 3.

Summary of CTNS mutations in cystinosis (by ClinVar) (http://www.ncbi.nlm.nih.gov/clinvar/?term=ctnsall).

Variation
Location 
Condition(s)  Clinical significance (last reviewed) 
CTNS, 1-BP INS, -303T  Cystinosis, ocular nonnephropathic  Pathogenic (October 1, 2001) 
CTNS, -303G-T  Cystinosis, ocular nonnephropathic  Pathogenic (October 1, 2001) 
CTNS, -295G-C  Cystinosis  Pathogenic (October 1, 2001) 
CTNS, 5-BP DEL, NT545  Cystinosis  Pathogenic (November 1, 1998) 
CTNS, IVS7AS, C-G, -10  Juvenile nephropathic cystinosis  Pathogenic (December 1, 1999) 
CTNS, 4-BP DEL, 18GACT  Juvenile nephropathic cystinosis, Cystinosis  Pathogenic (November 1, 2009) 
CTNS, 2-BP DEL, 397TG  Cystinosis  Pathogenic (April 1, 1998) 
NC_000017.11:g.3600934_3658165del57232  Cystinosis, ocular nonnephropathic, Juvenile nephropathic cystinosis  Pathogenic (August 11, 2011) 
NM_080704.3(TRPV1):c.-34+7395T>C  Cystinosis  Benign (January 14, 2015) 
NM_004937.2(CTNS):c.18_21delGACT (p.Thr7Phefs)  Cystinosis  Pathogenic (April 24, 2015) 
NM_001031681.2(CTNS):c.124G>A (p.Val42Ile)  Cystinosis, atypical nephropathic  Pathogenic (December 1, 1999) 
NM_001031681.2(CTNS):c.198_218del21 (p.Ile67_Pro73del)  Cystinosis  Pathogenic (July 31, 2014) 
NM_001031681.2(CTNS):c.199_219del21 (p.Ile67_Pro73del)  Cystinosis  Likely pathogenic (July 31, 2014) 
NM_004937.2(CTNS):c.225+5_225+6delGTinsCC  Cystinosis  Likely pathogenic (July 21, 2014) 
NM_001031681.2(CTNS):c.283G>T (p.Gly95Ter)  Cystinosis  Pathogenic (April 1, 1998) 
NM_004937.2(CTNS):c.292dupA (p.Thr98Asnfs)  Cystinosis  Likely pathogenic (April 3, 2014) 
NM_001031681.2(CTNS):c.329G>T (p.Gly110Val)  Cystinosis, atypical nephropathic  Pathogenic (December 1, 2002) 
NM_001031681.2(CTNS):c.356G>A (p.Arg119His)  Not specified  Benign (April 15, 2015) 
NM_004937.2(CTNS):c.414G>A (p.Trp138Ter)  Cystinosis  Pathogenic (April 24, 2015) 
NM_004937.2(CTNS):c.416C>T (p.Ser139Phe)  Juvenile nephropathic cystinosis, atypical nephropathic, cystinosis  Pathogenic (May 30, 2014) 
NM_004937.2(CTNS):c.473T>C (p.Leu158Pro)  Cystinosis  Pathogenic (August 11, 2011) 
NM_001031681.2(CTNS):c.506G>A (p.Gly169Asp)  Cystinosis  Pathogenic (November 1, 1998) 
NM_004937.2(CTNS):c.559_561+24del27  Cystinosis  Pathogenic (February 15, 2015) 
NM_004937.2(CTNS):c.561+1delG  Cystinosis  Likely pathogenic (November 24, 2014) 
NM_004937.2(CTNS):c.589G>A (p.Gly197Arg)  Cystinosis, ocular nonnephropathic, cystinosis  Pathogenic (March 3, 2014) 
NM_001031681.2(CTNS):c.612C>T (p.Asn204=)  Not provided  Uncertain significance (March 30, 2015) 
NM_004937.2(CTNS):c.613G>A (p.Asp205Asn)  Cystinosis  Pathogenic (August 11, 2011) 
NM_004937.2(CTNS):c.614_616delACG (p.Asp205del)  Cystinosis  Likely pathogenic (March 12, 2014) 
NM_004937.2(CTNS):c.696dupC (p.Val233Argfs)  Cystinosis  Pathogenic (August 11, 2011) 
NM_004937.2(CTNS):c.809_811delCCT (p.Ser270del)  Cystinosis  Likely pathogenic (October 16, 2014) 
NM_004937.2(CTNS):c.853-3C>G  Cystinosis, ocular nonnephropathic  Pathogenic (August 11, 2011) 
NM_004937.2(CTNS):c.926dupG (p.Ser310Glnfs)  Cystinosis  Likely pathogenic (March 7, 2014) 
NM_001031681.2(CTNS):c.969C>G (p.Asn323Lys)  Juvenile nephropathic cystinosis  Pathogenic (August 1, 1999) 
NM_001031681.2(CTNS):c.1015G>A (p.Gly339Arg)  Cystinosis  Pathogenic (September 1, 2001) 
Discussion

The incidence of cystinosis is estimated to be between 1 in 100,000 and 1 in 200,000 worldwide; it is predicted to be much higher in Iran due to the nation's high rate of consanguinity. The CTNS gene spans 26.6kbp and contains 13 exons. A 57,257-bp deletion8 was found to be responsible for approximately half of Northern European and North American cystinosis patients10,11; this deletion is easily detected by a multiplex PCR amplification assay.21 Cystinosis has been reported in different ethnic groups, and about 200 different mutations have been described to date, including mutations in the promoter region, missense, nonsense, deletion, insertion, and splice-site mutations.9–11,22 However mutational spectrum of CTNS in African, Mediterranean, and middle east populations seems to be different (Table 4). Meanwhile in a population of Saudi Arabian origin, it showed small deletions and point mutations.24 None of the Egyptian patients with infantile nephropathic cystinosis who underwent molecular analysis had the 57-kb deletion,24 consistent with a study in Turkey.12 These patients showed frameshift, nonsense, missense, and intronic splicing mutations. Previous studies of nephropathic cystinosis in patients of unrelated families from southwest Iran also showed point mutations.13 Also we have not found this CTNS large deletion in any of screened Iranian patients with cystinosis. Since the 57-kb deletion originated approximately 1500 years ago in northern Europe,9 it is not surprising that it is absent among Iranian cystinosis patients.

Table 4.

Summarized previous reports of genetic diagnosis of cystinosis in African and Mediterranean countries.

    References 
African–American origin
(IVS 5+5 GT→CC)  Homozygous  17 
57-kb deletion  Homozygous   
928G→A
57-kb deletion 
Heterozygous   
Tunisian origin
c.771_793del (p.Gly258Serfs*30)    15 
20-kb deletion, Deleted intron 1 CARKL–intron 6 CTNS     
c.1515G>A (p.G308R)  Homozygous   
c.771_793del (p.Gly258Serfs*30)  Homozygous   
Spanish origin
416C-T transition (S139F)  Compound heterozygous  19 
GACT del, at nucleotide 357     
Italian origin
569–577delTTCTCCTCA    7 
c.922G>A     
c.681+1G>A     
c.696–697insC     
c.861G>A     
c.1015G>A     
c.225+3A>T     
c.890G>A     
c.659–665delTCGTGCA     
c.18-21delGACT     
c.699-700delGT     
1366del12bp     
-295G>C     
Egyption origin
Exons 6, c.260_261delTT (p.F87SfsX36)
Exon 8, c.560A>G (p.K187R) 
Heterozygous  23 
Exons 10, c.734G>A (p.W245fsX)
Exon 12, c.1032delCinsTG (p.F345CfsX19) 
Heterozygous   
Exon 12, c.1084G>A; pG362R  Homozygous   
IVS3+5g>t     
1-593-41C>T     
Exon 10,c.829dup (p.T277NfsX19)  Homozygous   
Exon 11, c.922G>A (p. G308R)  Homozygous   
Exon 10, 809_811del (p.S270del)  Homozygous   
Exon 3, c.15G>A (p.W5X)  Homozygous   
Exon 9, c.681G>A (E227E)  Homozygous   
Exon 12, c.1015G>A  Homozygous   
Turkish origin
c.1015 G>A; p.G339R
c.451A>G; p.R151G 
Heterozygous  12 
c.18_21delGACT; p.T7FX7  Homozygous   
18_21delGACT;p.T7X7
c.470 G>A; p.G157D 
Heterozygous   
c.518A>G, p.Y173C  Homozygous   
c.470 G>A; p.G157D  Homozygous   
c.140+1 G>T  Homozygous   
Moraco
c.61+5G>A (5′ splice site IVS3)    19 
c.922G>A (p.G308R)     
Jordanian origin
c.779C>T (p.Thr26Ile)    8 
exon 10, c.829dupA (p.Thr277Asnfs*19)     
Exon 11, c.890G>A (p.Trp297X).     
Iranian origin
Exon 1–2
-303TG Ins 5′UTR
-303 G>T 5′UTR 
  This Study 
Exon 3
c.18-21del GACT (p.T7fsX7) 
   
Exon 4
c.119C>G (p.T40S)
c.124G>A (p.V42I)
c.73A>T (p.S25C)
c.92insG (p.V31GfsX28)
c.120delC (p.T40TfsX10)
IVS3-2A>C 
Heterozygous   
Exon 5
c.194 A>G (p. K65R) 
Heterozygous   
Exon 6–7
c.250A>G (p.N84D)
c.261T>A (p. F87L)
c.323 del A (p. Q108RfsX10)
c.261T>A (p. F87L)
c.257–258 del CT (p.S86F fsX37) 
Heterozygous   
Exon 8–9
c.647C>G (p.T216R)
c.661insT (p.V221CfsX6) 
Heterozygous   
Exon 10, c.779C>T (p.260I)  Heterozygous   
Exon 11–12
c.969C>A (p.N323K)
IVS 11+70T
c.1015G>A (p.G339R) 
Heterozygous   

In this study, most of the patients showed novel mutations although some previously reported mutations have also been detected. Moreover, half of the mutations have been observed in the exons 6 and 7 of the CTNS gene, which is highly suggestive of genetic analysis of these two exons by Sanger sequencing as Tier 1 in Iranian population. Utilizing this recommendation in suspected patients with nephropathic cystinosis in Iran, the process of mutation detection is facilitated, and the cost and time of CTNS mutation detection may be reduced.

The c.779C>T was primarily described in a heterozygous genotype in 5 Italian and some other Jordanian patients.7,8 Moreover, its association with some mutant alleles has been introduced as an additional DNA marker for prenatal molecular diagnostics of cystinosis in Jordanian families.8 Also G339R, one detected mutation in a patient, has already been proposed as a common cause of nephropathic cystinosis in the south western Ontario Amish Mennonite population.20 Overall, all 28 patients in this study including the ones with novel mutations presented with Fanconi syndrome between 6 and 24 months old, and also developed eye involvement. So we admit that clinical feature of the studied patients was consistent with and similar to what is already mentioned in the literature.

Conflict of interest

The authors declare no competing financial interest.

Referencias Bibliográficas
1.
G.A. McDowell,G.A. William,L.A. Stephenson,J.A. Schneider,J. Weissenbach,M.H. Polymeropoulos
Linkage of the gene for cystinosis to markers on the short arm of chromosome-17
.Nat Genet, 10 (1995), pp. 246-248 http://dx.doi.org/10.1038/ng0695-246
2.
F. Shams,I. Livingstone,D. Oladiwura,K. Ramaesh
Treatment of corneal cystine crystal accumulation in patients with cystinosis
.Clin Ophthalmol, 8 (2014), pp. 2077-2084 http://dx.doi.org/10.2147/OPTH.S36626
3.
W.A. Gahl,J.G. Thoene,J.A. Schneider
Cystinosis
.N Engl J Med, 347 (2002), pp. 111-121 http://dx.doi.org/10.1056/NEJMra020552
4.
R. Kleta,F. Kaskel,R. Dohil,P. Goodyer,L.M. Guay-Woodford,E. Harms
First NIH/Office of rare diseases conference on cystinosis: past, present, and future
.Pediatr Nephrol, 20 (2005), pp. 452-454 http://dx.doi.org/10.1007/s00467-004-1777-5
5.
V. Kalatzis,C. Antignac
New aspects of the pathogenesis of cystinosis
.Pediatr Nephrol, 18 (2003), pp. 207-215 http://dx.doi.org/10.1007/s00467-003-1077-5
6.
R.L. Pisoni,J.G. Thoene,H.N. Christensen
Detection and characterization of carrier-mediated cationic amino acid transport in lysosomes of normal and cystinotic human fibroblasts. Role in therapeutic cystine removal?
.J Biol Chem, 260 (1985), pp. 4791-4798
7.
S. Mason,G. Pepe,R. Dall’Amico,S. Tartaglia,S. Casciani,M. Greco
Mutational spectrum of the CTNS gene in Italy
.Eur J Hum Genet, 11 (2003), pp. 503-508 http://dx.doi.org/10.1038/sj.ejhg.5200993
8.
S. Jaradat,B. Al-Rababah,I. Hazza,K. Akl,E. Saca,D. Al-Younis
Molecular analysis of the CTNS gene in Jordanian families with nephropathic cystinosis
.Nefrologia, 35 (2015), pp. 547-553 http://dx.doi.org/10.1016/j.nefro.2015.09.009
9.
L. Chkioua,S. Khedhiri,O. Grissa,C. Aloui,H.B. Turkia,S. Ferchichi
Genetic basis of cystinosis in Tunisian patients: identification of novel mutation in CTNS gene
.Meta Gene, 25 (2015), pp. 144-149
10.
M. Town,G. Jean,S. Cherqui,M. Attard,L. Forestier,S.A. Whitmore
A novel gene encoding an integral membrane protein is mutated in nephropathic cystinosis
.Nat Genet, 18 (1998), pp. 319-324 http://dx.doi.org/10.1038/ng0498-319
11.
V. Shotelersuk,D. Larson,Y. Anikster,G. McDowell,R. Lemons,I. Bernardini
CTNS mutations in an American-based population of cystinosis patients
.Am J Hum Genet, 63 (1998), pp. 1352-1362 http://dx.doi.org/10.1086/302118
12.
R. Topaloglu,T. Vilboux,T. Coskun,F. Ozaltin,B. Tinloy,M. Gunay-Aygun
Genetic basis of cystinosis in Turkish patients: a single-center experience
.Pediatr Nephrol, 27 (2012), pp. 115
13.
S. Shahkarami,H. Galehdari,A. Ahmadzadeh,M. Babaahmadi,M. Pedram
The first molecular genetics analysis of individuals suffering from nephropatic cystinosis in the southwestern Iran
14.
M.A. Alcántara-Ortigoza,L. Belmont-Martínez,M. Vela-Amieva,A. González-Del Angel
Analysis of the CTNS gene in nephropathic cystinosis Mexican patients: report of four novel mutations and identification of a false positive 57-kb deletion genotype with LDM-2/exon 4 multiplex PCR assay
.Genet Test, 12 (2008), pp. 409-414 http://dx.doi.org/10.1089/gte.2008.0014
15.
C. Phornphutkul,Y. Anikster,M. Huizing,P. Braun,C. Brodie,J.Y. Chou
The promoter of a lysosomal membrane transporter gene, CTNS, binds Sp-1, shares sequences with the promoter of an adjacent gene, CARKL, and causes cystinosis if mutated in a critical region
.Am J Hum Genet, 69 (2001), pp. 712-721 http://dx.doi.org/10.1086/323484
16.
P. Yeetong,S. Tongkobpetch,P. Kingwatanakul,T. Deekajorndech,I.M. Bernardini,K. Suphapeetiporn
Two novel CTNS mutations in cystinosis patients in Thailand
.Gene, 15 (2012), pp. 323-325
17.
R. Kleta,Y. Anikster,C. Lucero,V. Shotelersuk,M. Huizing,I. Bernardini
CTNS mutations in African American patients with cystinosis
.Mol Genet Metab, 74 (2001), pp. 332-337 http://dx.doi.org/10.1006/mgme.2001.3218
18.
Y. Anikster,C. Lucero,J. Guo,M. Huizing,V. Shotelersuk,I. Bernardini
Ocular nonnephropathic cystinosis: clinical, biochemical, and molecular correlations
.Pediatr Res, 47 (2000), pp. 17-23
19.
J. Macías-Vidal,M. Rodés,J.M. Hernández-Pérez,M.A. Vilaseca,M.J. Coll
Analysis of the CTNS gene in 32 cystinosis patients from Spain
20.
C.A. Rupar,D. Matsell,S. Surry,V. Siu
A G339R mutation in the CTNS gene is a common cause of nephropathic cystinosis in the south western Ontario Amish Mennonite population
.J Med Genet, 38 (2001), pp. 615-616
21.
Y. Anikster,C. Lucero,J.W. Touchman,M. Huizing,G. McDowell,V. Shotelersuk
Identification and detection of the common 65-kb deletion breakpoint in the nephropathic cystinosis gene (CTNS)
.Mol Genet Metab, 66 (1999), pp. 111-116 http://dx.doi.org/10.1006/mgme.1998.2790
22.
M.A. Aldahmesh,A. Humeidan,H.A. Almojalli,A.O. Khan,M. Rajab,A.A. AL-Abbad
Characterization of CTNS mutations in Arab patients with cystinosis
.Ophthal Genet, 30 (2009), pp. 185-189 http://dx.doi.org/10.3109/13816810903200953
23.
N.A. Soliman,M.A. Elmonem,L. van den Heuvel,R.H. Abdel Hamid,M. Gamal,I. Bongaers
Mutational spectrum of the CTNS gene in Egyptian patients with nephropathic cystinosis
.JIMD Rep, 14 (2014), pp. 87-97 http://dx.doi.org/10.1007/8904_2013_288
24.
S.A. Miller,D.D. Dykes,H.F. Polesky
A simple salting out procedure for extracting DNA from human nucleated cells
.Nucleic Acids Res, 16 (1988), pp. 1215
Órgano Oficial de la Sociedad Española de Nefrología
Contactar | Web Map | Aviso legal